ID: 988877723

View in Genome Browser
Species Human (GRCh38)
Location 5:35466625-35466647
Sequence ATGCTGAGATAGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988877723_988877725 -8 Left 988877723 5:35466625-35466647 CCATTTTTCCTCTATCTCAGCAT No data
Right 988877725 5:35466640-35466662 CTCAGCATGCCAGACACAAGAGG No data
988877723_988877727 10 Left 988877723 5:35466625-35466647 CCATTTTTCCTCTATCTCAGCAT No data
Right 988877727 5:35466658-35466680 AGAGGCTTTGCTATAACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988877723 Original CRISPR ATGCTGAGATAGAGGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr