ID: 988879539

View in Genome Browser
Species Human (GRCh38)
Location 5:35486222-35486244
Sequence GAGCCATGGTTGGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988879539_988879545 5 Left 988879539 5:35486222-35486244 CCTGGACCTGCCAACCATGGCTC No data
Right 988879545 5:35486250-35486272 GGACCCGTCTACTGCTCCTGTGG No data
988879539_988879548 17 Left 988879539 5:35486222-35486244 CCTGGACCTGCCAACCATGGCTC No data
Right 988879548 5:35486262-35486284 TGCTCCTGTGGCCCCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988879539 Original CRISPR GAGCCATGGTTGGCAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr