ID: 988879778

View in Genome Browser
Species Human (GRCh38)
Location 5:35488740-35488762
Sequence ATGCAAGAGTAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988879778_988879780 23 Left 988879778 5:35488740-35488762 CCATGCTCCATCTACTCTTGCAT No data
Right 988879780 5:35488786-35488808 TTATTGAGTGCCTATTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988879778 Original CRISPR ATGCAAGAGTAGATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr