ID: 988879780

View in Genome Browser
Species Human (GRCh38)
Location 5:35488786-35488808
Sequence TTATTGAGTGCCTATTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988879778_988879780 23 Left 988879778 5:35488740-35488762 CCATGCTCCATCTACTCTTGCAT No data
Right 988879780 5:35488786-35488808 TTATTGAGTGCCTATTATGTAGG No data
988879779_988879780 16 Left 988879779 5:35488747-35488769 CCATCTACTCTTGCATGTATTCA No data
Right 988879780 5:35488786-35488808 TTATTGAGTGCCTATTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988879780 Original CRISPR TTATTGAGTGCCTATTATGT AGG Intergenic
No off target data available for this crispr