ID: 988879780 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:35488786-35488808 |
| Sequence | TTATTGAGTGCCTATTATGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988879778_988879780 | 23 | Left | 988879778 | 5:35488740-35488762 | CCATGCTCCATCTACTCTTGCAT | No data | ||
| Right | 988879780 | 5:35488786-35488808 | TTATTGAGTGCCTATTATGTAGG | No data | ||||
| 988879779_988879780 | 16 | Left | 988879779 | 5:35488747-35488769 | CCATCTACTCTTGCATGTATTCA | No data | ||
| Right | 988879780 | 5:35488786-35488808 | TTATTGAGTGCCTATTATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988879780 | Original CRISPR | TTATTGAGTGCCTATTATGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||