ID: 988891648

View in Genome Browser
Species Human (GRCh38)
Location 5:35624062-35624084
Sequence ATCACCATGTGGAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988891643_988891648 -3 Left 988891643 5:35624042-35624064 CCAGAACCTGTGCTCTCCTTATC 0: 1
1: 0
2: 1
3: 12
4: 221
Right 988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG 0: 1
1: 0
2: 0
3: 19
4: 195
988891642_988891648 23 Left 988891642 5:35624016-35624038 CCACAAGTCTAACAGAGAATCTT 0: 1
1: 0
2: 0
3: 11
4: 158
Right 988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG 0: 1
1: 0
2: 0
3: 19
4: 195
988891644_988891648 -9 Left 988891644 5:35624048-35624070 CCTGTGCTCTCCTTATCACCATG 0: 1
1: 0
2: 0
3: 21
4: 188
Right 988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG 0: 1
1: 0
2: 0
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988891648 Original CRISPR ATCACCATGTGGAATGTGGA TGG Intronic
900362686 1:2297532-2297554 ACCACCATGTGGACTGTGGCTGG + Intronic
902087557 1:13875039-13875061 ATCCCCATGTGGCTGGTGGAAGG - Intergenic
902775514 1:18672117-18672139 ATCACCTTGGTGAATGAGGAGGG - Intronic
908990097 1:70076400-70076422 ATCACCATGTTGAATGGGGTAGG + Intronic
911457658 1:98147368-98147390 ATCACCCTCAGTAATGTGGATGG + Intergenic
916008501 1:160683189-160683211 ATCACCATGGGAAATGCAGAAGG - Intronic
918962746 1:191301786-191301808 ATGACCATGTGGCTTGGGGATGG + Intergenic
919117748 1:193301943-193301965 ATAAACATGTGGAATGTTTATGG + Intergenic
919124818 1:193381191-193381213 GTCCCCTTGTGGAAGGTGGAAGG - Intergenic
919802962 1:201364577-201364599 CTCACCATGAGGAATGTTGGAGG - Intronic
920748188 1:208648802-208648824 ATTACCATGTGGATATTGGATGG - Intergenic
922467541 1:225854382-225854404 ATCCCCATGTGGGATGAGGGCGG + Intronic
1065939461 10:30551092-30551114 AACAGCATGTGGGATGTGCATGG + Intergenic
1067452189 10:46388637-46388659 ATGACCATGTGGTGTGTGCAGGG + Intronic
1067585048 10:47471118-47471140 ATGACCATGTGGTGTGTGCAGGG - Intronic
1068198898 10:53757012-53757034 ATCCCCAAGTGGGATGAGGAGGG - Intergenic
1068961136 10:62867774-62867796 ATCACCAGGTTGAACATGGATGG + Intronic
1069083299 10:64111475-64111497 TTCAACATGTGGATTTTGGAGGG - Intergenic
1069627596 10:69877826-69877848 CACAGCATGTGGCATGTGGAAGG - Intronic
1072051567 10:91709233-91709255 ATAACCATGTTTAATGTAGAGGG - Intergenic
1073583726 10:104689376-104689398 CACACATTGTGGAATGTGGATGG - Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1075909041 10:126107704-126107726 ATTCTCATGTGCAATGTGGATGG - Intronic
1076296025 10:129385515-129385537 TTGGACATGTGGAATGTGGATGG + Intergenic
1076511675 10:131018645-131018667 TTCACCAAGTGGGATGTGCAGGG - Intergenic
1078936388 11:15954747-15954769 ATCCCCATGTGCAAAGTGCAGGG + Intergenic
1079381385 11:19940971-19940993 AACACAATCTGGAATGTGCATGG - Intronic
1080257997 11:30313889-30313911 ATAACCATGTGGATGGGGGAGGG + Intergenic
1083156856 11:60828650-60828672 ACCACCACGTGGTCTGTGGAGGG + Intergenic
1087447085 11:98268898-98268920 AACACCATGTGGAAGGTGCAGGG + Intergenic
1089468246 11:118700067-118700089 ATCAAGAAGTGGAATGTGGCCGG + Intergenic
1089663003 11:119997846-119997868 AGCACCATGTTGAATGGGGCTGG + Intergenic
1091360588 11:134975956-134975978 ATCACCAGCTGGTAAGTGGAGGG - Intergenic
1091514141 12:1161098-1161120 AACACTATGCGGAATGAGGACGG - Intronic
1093788297 12:23217199-23217221 ATCACCATGTTGGATTTGGAGGG + Intergenic
1093844344 12:23950486-23950508 AACACGATGTGCGATGTGGAGGG + Intronic
1097463876 12:59898443-59898465 ATCACCATCCATAATGTGGATGG - Intergenic
1098043435 12:66376319-66376341 GTCACCATAAGGAATGTGAATGG - Intronic
1098665649 12:73159587-73159609 GTAACCATGTGGAATGTGTAAGG - Intergenic
1101031015 12:100660255-100660277 ATAACTATGTGGGATGTGGAGGG + Intergenic
1102736447 12:115165028-115165050 ATCACCTGGTGGAAAGAGGAAGG - Intergenic
1104736946 12:131140843-131140865 GTCACCATGTGGCAGGTGGCTGG - Exonic
1104769293 12:131350946-131350968 AAGAAGATGTGGAATGTGGAGGG + Intergenic
1106525191 13:30534207-30534229 ATCAGAATGAGGAATTTGGACGG - Intronic
1108840205 13:54603903-54603925 ATCACAATATGAAATTTGGAGGG - Intergenic
1112149029 13:96736063-96736085 ATCAGAAGGTGGAAAGTGGAAGG + Intronic
1112444713 13:99453660-99453682 ATCATCATGTTGACAGTGGATGG + Intergenic
1112514446 13:100040049-100040071 ATAGCCATGTGACATGTGGAAGG + Intergenic
1113273237 13:108698393-108698415 ATCACCATGTGAAATATCAAAGG - Intronic
1114080883 14:19200749-19200771 AGCAGCCTGTGGAATGTGGGTGG - Intergenic
1115420917 14:33194746-33194768 GTCACTTGGTGGAATGTGGATGG + Intronic
1117190528 14:53285944-53285966 CTCACGTGGTGGAATGTGGAAGG + Intergenic
1117933086 14:60867733-60867755 TTCACCATGTGCAATGAGGAAGG - Intronic
1118346527 14:64945205-64945227 ATCACCGTGTGAGATGGGGAGGG - Intronic
1120694221 14:87625999-87626021 ATCACCCTCTCCAATGTGGATGG - Intergenic
1122400690 14:101465635-101465657 TTCACCATCTGGACTGTGCAAGG - Intergenic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1124940575 15:34213856-34213878 GTCACCAGGTGGAACGTGGTGGG + Intergenic
1126243995 15:46481948-46481970 ATCACATGGTGGAAGGTGGAAGG - Intergenic
1127493284 15:59485026-59485048 CTCACCCTGGGGAAAGTGGAGGG + Intronic
1128488143 15:68117577-68117599 ATCCACATGTGGAATCTGAAAGG - Intronic
1129115336 15:73362556-73362578 ACCACCTTGTGGCATTTGGACGG - Intronic
1131418607 15:92283793-92283815 ATGACCCTCTGTAATGTGGATGG + Intergenic
1131601723 15:93855953-93855975 ATCAGCATGACGAATGAGGATGG - Intergenic
1131617111 15:94028162-94028184 GTCACCAAGTGGAAAGTGGCAGG - Intergenic
1133930285 16:10226771-10226793 AGCCCCCTGTGGAATGAGGAGGG + Intergenic
1135975031 16:27103089-27103111 ATCACCCTGGGGATTCTGGATGG - Intergenic
1138548167 16:57731667-57731689 CTCACCAAGTGGGATGGGGAAGG + Intronic
1140211693 16:72975537-72975559 ATTACCATGTGGGATGGAGAAGG - Intronic
1140470777 16:75213122-75213144 TTCACCTGGTGGAAGGTGGAAGG - Intergenic
1141752885 16:85970977-85970999 ATCACCATCTTGATTGTGGTGGG - Intergenic
1143656101 17:8294635-8294657 ATCACCATCGGCAAGGTGGATGG - Exonic
1144029720 17:11308594-11308616 ATCAGCTTGTGAAATGAGGAGGG - Intronic
1146509219 17:33431239-33431261 ATCAGTATGTGGACTCTGGATGG - Intronic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1148896264 17:50840870-50840892 ATCATCATGGGGGAGGTGGACGG + Exonic
1153407303 18:4755207-4755229 AACACCATGTAGTATGTTGATGG + Intergenic
1153687846 18:7564966-7564988 ACCACCCTTTGAAATGTGGATGG + Intergenic
1155419305 18:25637254-25637276 ATTGCCTTGTGGTATGTGGAAGG - Intergenic
1155841370 18:30647880-30647902 ATCACCATGTGCCAGGTGTAGGG - Intergenic
1156872475 18:41962553-41962575 CTCACCATATGGGATGTGTATGG + Exonic
1157096525 18:44690104-44690126 ATAAGCATTTGGAATGGGGATGG + Intronic
1157533920 18:48444687-48444709 AGCACCTTGTGAAATGGGGATGG + Intergenic
1159507146 18:69352877-69352899 ATCAACATATGGATTCTGGAGGG - Intergenic
1161763475 19:6191724-6191746 TTCAACATGTGAATTGTGGAGGG + Intronic
1164675859 19:30100924-30100946 ACCACCATCTCCAATGTGGATGG - Intergenic
925426909 2:3757336-3757358 ATTGCCTTGTGGAATGTGGGGGG + Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929099158 2:38292619-38292641 ATCACCAGGTGGAACTTGGTGGG - Intergenic
929329477 2:40663242-40663264 ATCTACATGTGGAAGTTGGAAGG + Intergenic
933112447 2:78420736-78420758 TTCAGCATGTGAAATTTGGAGGG + Intergenic
934706439 2:96484852-96484874 ATCCCAAGGTGGAAGGTGGAGGG - Intergenic
934980680 2:98837118-98837140 TGCACCATGTGAAGTGTGGAAGG - Intronic
935514466 2:104019551-104019573 ATCACCATGTGGAATGGAATGGG + Intergenic
935514871 2:104023486-104023508 TTCAGCATATGGAATGTAGAAGG - Intergenic
939432679 2:142130905-142130927 AGCAGGATGTGGAAGGTGGAGGG + Exonic
940724202 2:157316184-157316206 ATCACCATATTGAATGTGCCTGG + Intergenic
942234310 2:173889536-173889558 AACACCATGTGGAAAGTGCAAGG - Intergenic
942328001 2:174791833-174791855 ATCACCATCTGGAGTGGGAATGG + Intergenic
942707246 2:178789560-178789582 ATCCCCATGAGGAAGGGGGAAGG - Intronic
944272622 2:197800767-197800789 ATCACCATGTATATTGGGGAGGG + Intergenic
946322978 2:218964288-218964310 ATCAACATGTGTCATGTGAAGGG - Intergenic
1172629562 20:36368849-36368871 ATAACCCTGTGGAAGGTGAAGGG + Intronic
1173842160 20:46164955-46164977 ATCACCAGCTGGGATGGGGATGG - Intergenic
1174870389 20:54175839-54175861 ATCACCAAGAGGAAAGTGGGGGG + Intergenic
1175086615 20:56464794-56464816 ATCCCAAGGTGGAAGGTGGAAGG + Intergenic
1178118059 21:29437437-29437459 ATCCTCATGAGGAATGTGAAAGG - Intronic
1178195542 21:30340688-30340710 ATCACCATATGAAATTTGAAGGG - Intergenic
1178222931 21:30681512-30681534 GTCACCATCTGGAAGATGGATGG + Intergenic
1178793035 21:35717895-35717917 TTCAACATGTGGATTTTGGAGGG - Intronic
1180499889 22:15921936-15921958 AGCAGCCTGTGGAATGTGGGTGG + Intergenic
1181311271 22:21946178-21946200 AGCACCATGTGGCAGGTGCATGG + Intronic
1181453183 22:23037637-23037659 AACACAAGATGGAATGTGGATGG - Intergenic
1181872406 22:25910468-25910490 TTCACCATATGAATTGTGGAGGG + Intronic
1181895715 22:26105800-26105822 AGCACCATGAGAAAAGTGGAAGG - Intergenic
1182943369 22:34299625-34299647 ATCAACATGAGCATTGTGGAGGG - Intergenic
1183385880 22:37514363-37514385 AAAACCATGTGGCATGGGGAAGG - Intronic
1184018181 22:41801231-41801253 AGCAGGAGGTGGAATGTGGAGGG + Intronic
1184726181 22:46347963-46347985 ATCACCCTGTGGCATAAGGAAGG - Intronic
1184922154 22:47613337-47613359 ATAACCATGTGGACAGTGGAGGG - Intergenic
1184922173 22:47613425-47613447 ATAACCATGTGGACAGTGGAGGG - Intergenic
951249643 3:20380059-20380081 AACACTATGTGGAATGTGGGGGG + Intergenic
951720047 3:25688719-25688741 ATCAGCATGTGGCATGAGAATGG - Intergenic
952217763 3:31294850-31294872 ATCACCAGGTGGAGTGAGGTTGG - Intergenic
953444801 3:42954079-42954101 ATAACCATGAGAAATGTGTATGG - Intronic
955086216 3:55705498-55705520 ATCAACCTGTGGCATTTGGAAGG + Intronic
956255971 3:67283632-67283654 ATCCCAGTGTGGAAGGTGGAAGG + Intergenic
959121075 3:102232946-102232968 ATAACAGTGTGGAAAGTGGACGG - Intronic
959219565 3:103499378-103499400 ATAACCATGTGGACAGTGGGAGG - Intergenic
961359102 3:126356441-126356463 ACCACCATATGGGATGGGGACGG + Intronic
962159286 3:132981845-132981867 ATTAGCAAGTGGAGTGTGGATGG - Intergenic
963921060 3:150906255-150906277 ATTACCCTTTGCAATGTGGATGG + Intronic
964964315 3:162472131-162472153 ATCACATGGTGGAAGGTGGAAGG + Intergenic
965215345 3:165856344-165856366 ACAACCATGTGGAAAGTGAAAGG - Intergenic
967424682 3:189313152-189313174 ATCTCCATCTGGAATGTGAGAGG + Intronic
969243438 4:5916922-5916944 ATCACTATGTGGACTGAAGAGGG + Intronic
972367284 4:38388031-38388053 ATCCCCAGCTGGAAAGTGGAAGG - Intergenic
974000710 4:56508043-56508065 ATTAAAATGTGGAATGTGGGGGG + Intronic
977502009 4:97852453-97852475 CTCACCATGAAGTATGTGGAAGG + Intronic
979080186 4:116329048-116329070 ATCAACATGTGCATTTTGGAAGG + Intergenic
980002019 4:127500720-127500742 ATTTCCAGGTGGAATGTTGAAGG - Intergenic
981796881 4:148605629-148605651 AACACCATGTGAAATCTAGATGG - Intergenic
985708927 5:1417377-1417399 ATCATCATGTAGCATGTGGATGG - Intronic
987743199 5:21936715-21936737 ATCCCCATGTGTCATGGGGAGGG + Intronic
988891648 5:35624062-35624084 ATCACCATGTGGAATGTGGATGG + Intronic
991749717 5:69787816-69787838 ATCCCCATGTGTCATGGGGAGGG - Intergenic
991763393 5:69946824-69946846 ATCCCCATGTGTCATGGGGAGGG + Intergenic
991783934 5:70171305-70171327 ATCCCCATGTGTCATGGGGAGGG - Intergenic
991801296 5:70367630-70367652 ATCCCCATGTGTCATGGGGAGGG - Intergenic
991827303 5:70642412-70642434 ATCCCCATGTGTCATGGGGAGGG + Intergenic
991842622 5:70821884-70821906 ATCCCCATGTGTCATGGGGAGGG + Intergenic
991876379 5:71171680-71171702 ATCCCCATGTGTCATGGGGAGGG - Intergenic
994303353 5:98173297-98173319 ATGTGCATGTGGAATTTGGAAGG - Intergenic
995446794 5:112253873-112253895 ATTACCATGTAAAATGTGAAAGG + Intronic
997240418 5:132302490-132302512 ATCCCCATTTGGAATGAAGAAGG + Intronic
997855959 5:137373046-137373068 ATCACATGGTGGAAGGTGGAAGG - Intronic
1001305246 5:170567676-170567698 AACACCATGGTGGATGTGGATGG + Intronic
1001791011 5:174458287-174458309 GTCACCATGTAGAATTTAGAAGG - Intergenic
1003054835 6:2808780-2808802 AACAGCAGGTGGAATGGGGATGG + Intergenic
1005098181 6:22141362-22141384 AGCACAGTGTGGAATGTTGATGG + Intergenic
1006241509 6:32683915-32683937 ATCACATGGTGGAAGGTGGAGGG - Intergenic
1006812265 6:36827525-36827547 CTCAACATGTGGTATTTGGACGG - Intronic
1008798094 6:55330666-55330688 CTCACCATGTGCAATCTGGAAGG - Intronic
1009298714 6:61987882-61987904 ATGACCATTTGGAGTATGGATGG - Intronic
1009388142 6:63111629-63111651 ACCACCATTTGGAATGTGCTAGG + Intergenic
1009847742 6:69154632-69154654 ATTACCATGTGCTATGTGGGAGG - Intronic
1010855521 6:80833616-80833638 GTCACCATGGGGTATGTGGTAGG + Intergenic
1015691484 6:135929058-135929080 ATTACCAAGTGCTATGTGGAAGG + Intronic
1016409541 6:143767665-143767687 ATCACATGGTGGAAGGTGGAAGG + Intronic
1016481920 6:144491371-144491393 ATCACCATGTGAAGTTAGGAGGG + Intronic
1019908041 7:4079558-4079580 ATCTCCAGGTGGATTGTTGAGGG + Exonic
1021220910 7:17974263-17974285 ATCCCTATGTGGGTTGTGGAAGG - Intergenic
1022446177 7:30472566-30472588 CTCACCATGTGAACTTTGGAGGG - Intronic
1026929932 7:74218115-74218137 GTCCCCATGTGGGAGGTGGAGGG + Intronic
1031508281 7:122614865-122614887 ATCACCATGTGTTATTTGAAAGG - Intronic
1033232948 7:139616031-139616053 CAGACCATGGGGAATGTGGAGGG - Intronic
1033896509 7:146077590-146077612 ATAAACATGGGGAAGGTGGAGGG + Intergenic
1034211354 7:149365782-149365804 AAAACCAAGTGGAAAGTGGAAGG - Intergenic
1034996801 7:155582442-155582464 TTCACCATGTGGATTTTGGGGGG - Intergenic
1037972917 8:23187040-23187062 ATCACCTGGTGAAAGGTGGAAGG - Intergenic
1038482763 8:27913103-27913125 ATCACCCTGTGGAGTTTGGCTGG + Intronic
1042537709 8:69875461-69875483 ATCCCCATGTGGGATCTGGTGGG - Intergenic
1042690514 8:71492909-71492931 ATCAGAAGGTGGAATGTGGAAGG - Intronic
1042997977 8:74721865-74721887 ATAACCATCTGGAATATGGTAGG - Intronic
1045091800 8:98753466-98753488 ATCAGAAGGTGGAAGGTGGAAGG + Intronic
1046627105 8:116586666-116586688 ATCACCCTCTGTAATGTGGGTGG - Intergenic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1048718630 8:137297553-137297575 ATCACAATCTGCAGTGTGGAGGG - Intergenic
1049334100 8:142073272-142073294 ATGACCCTCTGTAATGTGGAGGG - Intergenic
1050328618 9:4522436-4522458 ATAACCATGTGAGATGTGCAGGG - Intronic
1053531816 9:38890071-38890093 GTCATCATGTGAAATCTGGAGGG - Intergenic
1054204039 9:62114491-62114513 GTCATCATGTGAAATCTGGAGGG - Intergenic
1054634323 9:67473874-67473896 GTCATCATGTGAAATCTGGAGGG + Intergenic
1056343714 9:85667513-85667535 ATCACTAAGTGAAAAGTGGATGG + Intronic
1056541217 9:87572979-87573001 ATCAGCATCTGGAAGGTGGGAGG - Intronic
1056735677 9:89207756-89207778 ATCACCATGAGCTATTTGGAAGG + Intergenic
1058329066 9:103736335-103736357 ATCAGCATGTGGATAGTGGTAGG + Intergenic
1059772752 9:117443194-117443216 ATCACAATGTGGAATGAAAAAGG - Intergenic
1060096543 9:120795685-120795707 ATCAACATGTTGGATGTTGAAGG + Intergenic
1186160469 X:6771989-6772011 AGAACCAAGTGAAATGTGGATGG + Intergenic
1186446929 X:9638135-9638157 CTCTCCATGTTCAATGTGGAGGG + Intronic
1188645848 X:32566203-32566225 ATCAACATGTGGAAATTAGAAGG + Intronic
1189127598 X:38464323-38464345 ATCACCAAGTGGAATATAGAAGG + Intronic
1190468315 X:50749628-50749650 TTCACCATGTAGAAAGAGGAAGG + Intronic
1190894946 X:54608222-54608244 ATCTCCATGTGGAAAGTGTCAGG - Intergenic
1192196378 X:69031518-69031540 ATCACCAAGGGGGATGTGGAGGG + Intergenic
1192532981 X:71905320-71905342 TTCAACATGTGGATTTTGGATGG - Intergenic
1192912884 X:75623948-75623970 ATGATCATGTGGAAGGTGAAGGG + Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1197415844 X:126171684-126171706 ATCACCAAGTGGAAGTTGTAAGG + Intergenic
1197949609 X:131880198-131880220 ATCACCATGTGGCATGTAGTAGG + Intergenic
1200747269 Y:6913214-6913236 ATCAACATGTGAAATGTAAAGGG - Intronic
1201497456 Y:14604018-14604040 GTCAACATGTGGATTCTGGAAGG - Intronic