ID: 988891655

View in Genome Browser
Species Human (GRCh38)
Location 5:35624104-35624126
Sequence CTGGCTAAGGGCCATTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 5, 3: 8, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988891646_988891655 23 Left 988891646 5:35624058-35624080 CCTTATCACCATGTGGAATGTGG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 988891655 5:35624104-35624126 CTGGCTAAGGGCCATTTTGATGG 0: 1
1: 0
2: 5
3: 8
4: 135
988891649_988891655 15 Left 988891649 5:35624066-35624088 CCATGTGGAATGTGGATGGCTTT 0: 1
1: 0
2: 2
3: 12
4: 205
Right 988891655 5:35624104-35624126 CTGGCTAAGGGCCATTTTGATGG 0: 1
1: 0
2: 5
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988891655 Original CRISPR CTGGCTAAGGGCCATTTTGA TGG Intronic
900523863 1:3119097-3119119 CAGGCCAAGGGCCTTTTTGGTGG + Intronic
907548254 1:55281872-55281894 CTGGCTGATGCCAATTTTGAAGG + Intergenic
911383551 1:97146269-97146291 CTCCCTAAGGACCATTTTTATGG - Intronic
916926289 1:169524349-169524371 CAGGCAAAGGGCCATATTAATGG + Intronic
918867420 1:189920984-189921006 CTGCCCTAGGGCCATTTTGGGGG - Intergenic
919872211 1:201830503-201830525 CAGGCTAAGGACCATTTTGAAGG + Intronic
922221475 1:223611637-223611659 CAGGCTAAGCCCCAATTTGAGGG + Intronic
924461592 1:244264649-244264671 ATAGCTAAAGTCCATTTTGAAGG + Intergenic
1069089804 10:64186341-64186363 CGAGCTAAGGACCATTTTGGGGG - Intergenic
1072120833 10:92404388-92404410 CTGGATATGAGACATTTTGAAGG - Intergenic
1072527436 10:96285815-96285837 CAGGCTAAGCCCCAATTTGAGGG + Intergenic
1076483327 10:130799319-130799341 CTGGCCAAGATCCATTTTCAAGG - Intergenic
1078127828 11:8585610-8585632 CTGCCTGAGGTCCATTTTGTTGG - Intronic
1079064647 11:17278801-17278823 CTTTCTAAGGACCCTTTTGAAGG + Intronic
1079784655 11:24656678-24656700 TTGGCTGAGTGCCATTTTAAAGG + Intronic
1081652695 11:44835026-44835048 TTGGCTAAGGGCCACCCTGAGGG + Intronic
1081842787 11:46215401-46215423 CAGGCTAAGGCCCAATTTGGGGG + Intergenic
1083912387 11:65717828-65717850 GGGGCTAAGGTCCATTATGAGGG + Exonic
1085646617 11:78227882-78227904 TTGGTTAAGAGGCATTTTGAGGG + Intronic
1087766517 11:102161011-102161033 CTGGCCAAGAGCCATTTTAGAGG - Intronic
1087988013 11:104709060-104709082 CTGGCTATGGGCCTTTTTGTGGG - Intergenic
1088177403 11:107069307-107069329 CTGGCAAAGGGCCTTCTTGCTGG - Intergenic
1088520714 11:110696383-110696405 ATGGCTAAGGACCAGTTTGCTGG - Intronic
1089596920 11:119586344-119586366 TTGGCCTAGGGCCACTTTGATGG - Intergenic
1091255693 11:134183062-134183084 CTGGCCCAGGGCCATTAGGACGG - Intronic
1097605689 12:61750730-61750752 TTGGCTATGGGCCATTATAAGGG + Intronic
1098936903 12:76490584-76490606 CTGGTTAAGAGCCACTTTCATGG + Intronic
1099741973 12:86649652-86649674 CTGGCCAAGAGCCAGATTGAAGG + Intronic
1101738120 12:107478840-107478862 GGGACTGAGGGCCATTTTGAGGG - Intronic
1103741707 12:123095732-123095754 CTGCCTCGGGGCCATTGTGAAGG + Intronic
1104252085 12:127104788-127104810 CTGGCTCAAGGTCATTTTTATGG - Intergenic
1105385323 13:19923965-19923987 CTGGCCATGGGACATTTTTATGG + Intergenic
1112469227 13:99672869-99672891 CTGGCTAATGGCAACTTTAAGGG - Intronic
1113260478 13:108556312-108556334 TTGGCTAATAGCCATTTTAATGG + Intergenic
1113280918 13:108786475-108786497 CTGGCCAAGGGTCATTTTGAAGG - Intronic
1114688378 14:24556848-24556870 CTGGCCATGGGACATTGTGATGG - Intergenic
1114999478 14:28404133-28404155 CTGGATTAGAGCCACTTTGAGGG - Intergenic
1116544247 14:46143243-46143265 CTGGTTAAGTACCATTTTAATGG - Intergenic
1116700712 14:48238042-48238064 CGGGCTAAGCCCCAATTTGAGGG - Intergenic
1123936690 15:25197423-25197445 CTGGCTGAGGGACATTTTCCCGG - Intergenic
1129885955 15:79037164-79037186 CTTGCTACTGGACATTTTGAAGG - Intronic
1130690018 15:86074188-86074210 CTGGTTAAGGGCCTGTTTCATGG + Intergenic
1131354478 15:91732746-91732768 CTGGCCAGGGGCCATTTTGAGGG - Intergenic
1132015539 15:98313201-98313223 GTGGGGAAGGGCCATTTTGGGGG - Intergenic
1132325577 15:100966912-100966934 CAAGTTAAGGGACATTTTGAAGG - Intronic
1133028414 16:2998501-2998523 CTGGCCAGGGCCCATTTTCATGG - Intergenic
1136681698 16:31969583-31969605 CTGGCTCAGGGCTTTTGTGATGG + Intergenic
1136782005 16:32911085-32911107 CTGGCTCAGGGCTTTTGTGATGG + Intergenic
1136887785 16:33942767-33942789 CTGGCTCAGGGCTTTTGTGATGG - Intergenic
1139750663 16:69107231-69107253 CTGGCTGAGGGACATTTTGGGGG + Intronic
1140677246 16:77344626-77344648 CTGCCCTAGGGCCATTTTGGTGG - Intronic
1140869422 16:79092893-79092915 CTAGATAAGGCCCATTTTCATGG + Intronic
1203084664 16_KI270728v1_random:1175071-1175093 CTGGCTCAGGGCTTTTGTGATGG + Intergenic
1145980883 17:29010810-29010832 CGGGCGAGGGGCCATTTTAATGG + Intronic
1152991841 18:370754-370776 CTGGCTAGGCACCATTTAGAAGG - Intronic
1154086262 18:11308369-11308391 CCGGCTAAGCCCCAGTTTGAGGG + Intergenic
1155829626 18:30497420-30497442 CTGCCTAAGGTCCATTGTTAGGG - Intergenic
1159229159 18:65583410-65583432 CTTGCTAAGAGAAATTTTGATGG - Intergenic
1159803356 18:72926795-72926817 CTGTTTCCGGGCCATTTTGATGG + Intergenic
1161743314 19:6039062-6039084 CTAGTTGAGGGCCATTTGGATGG - Intronic
1163674914 19:18650860-18650882 CCCGCTGAGGGCCATTCTGAGGG - Intronic
1164051888 19:21590907-21590929 CTGGGCAAGCCCCATTTTGAAGG + Intergenic
932335981 2:70931672-70931694 GTGGCTCAGGGCCATTTGGCGGG - Intronic
935831820 2:107008350-107008372 CTGGCTGAGGGCCAATGTGCTGG - Intergenic
936523704 2:113228624-113228646 CTGGCTAAGAACCATTGTGTTGG + Intronic
940216330 2:151307446-151307468 CTGGTTCAGGGACATTTTGGAGG - Intergenic
942533505 2:176938160-176938182 CTGGGTAAGAGCCATTTTGATGG + Intergenic
942678615 2:178453051-178453073 CTGGCAATGGGCCAATTTTAAGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947980298 2:234403120-234403142 CTGGCCAAGGTCCACTGTGATGG - Intergenic
1170317815 20:15061621-15061643 CTGGCTAAGAGCCATGGAGAAGG - Intronic
1170737214 20:19022404-19022426 CAGGCCATGGGCCACTTTGAGGG - Intergenic
1171313973 20:24169801-24169823 CAGGCTAAGTCCCATTTTGGGGG + Intergenic
1172278388 20:33693846-33693868 CTGGCTGAGGGACATTGTTAGGG + Intergenic
1172902263 20:38343939-38343961 CTGGCTAAGGTCCCTGCTGATGG - Intergenic
1172984829 20:38976603-38976625 ATAGCTAAGGGAGATTTTGAAGG - Intronic
1175311628 20:58015868-58015890 CTGGATGAGGGACATTTTCATGG - Intergenic
1175875840 20:62228915-62228937 CTGGCTCAGGGCCTTGTGGAGGG - Intergenic
1178026828 21:28477922-28477944 CAGGCTAAGCCCCAGTTTGAGGG + Intergenic
1179117335 21:38505883-38505905 CTCTCTAAAGGCCTTTTTGAGGG - Intronic
1179889380 21:44327944-44327966 GGGCCTAAGGGCCACTTTGAGGG + Intergenic
1183576061 22:38690165-38690187 CTGGGGAAAGGCCATTTTGAAGG + Intronic
949276437 3:2288439-2288461 ATGGCTTAGTGCCATTTTCATGG - Intronic
950134307 3:10569970-10569992 CTAGCCTGGGGCCATTTTGATGG + Intronic
956260662 3:67336746-67336768 CTGGCTAGGATCCATTGTGAAGG - Intergenic
956999765 3:74872370-74872392 CTGGCTAATGGAAACTTTGAAGG - Intergenic
957445099 3:80306862-80306884 CTGGCTAAGTGCCATTTCTGTGG - Intergenic
960534871 3:118804392-118804414 CTGGGGAAGGGCCATTTAAAGGG + Intergenic
960539482 3:118847816-118847838 CTGGGTCAGGGCCTTTTTTATGG - Intergenic
962848457 3:139290275-139290297 CTGGATAGGGGCCATTTGCAGGG - Intronic
967476448 3:189926227-189926249 CTTCCTAATGGCTATTTTGATGG - Intergenic
971854310 4:32024246-32024268 CAGGCTAAGCCCCAATTTGAGGG - Intergenic
972547723 4:40096482-40096504 CAGGTTATGGGCCATTTTAAGGG + Intronic
972796618 4:42427711-42427733 CTGGCCATGGGCCCTTTTCAGGG - Intronic
973105837 4:46335816-46335838 CGAGATAATGGCCATTTTGAAGG - Intronic
975610729 4:76200107-76200129 CTGGCAAAGGGCGCCTTTGAGGG - Intronic
980588202 4:134847698-134847720 ATGGCTAAAGGTCATTTTGGGGG - Intergenic
980745182 4:137002631-137002653 TTGGGTGAGGGCAATTTTGAGGG + Intergenic
984849436 4:184141306-184141328 CTGCCTCCGGGCCATTTTCATGG + Intronic
985365894 4:189232470-189232492 CTGGCTAAGAGCCATTTCTGGGG + Intergenic
985918219 5:2944360-2944382 CACGCTAAGGGCAATATTGAAGG - Intergenic
986922957 5:12709757-12709779 CTGGCTGAGGTCCATTCAGATGG + Intergenic
988891655 5:35624104-35624126 CTGGCTAAGGGCCATTTTGATGG + Intronic
991974060 5:72168822-72168844 CTGGCCAATGGGCATTTTCAAGG - Intronic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
997514658 5:134478531-134478553 CAGGCTAAGTCCCAATTTGAAGG + Intergenic
998607169 5:143647284-143647306 ACGGTCAAGGGCCATTTTGAAGG - Intergenic
999194250 5:149771318-149771340 CAGGCTCAGGGCCATTTAGGTGG + Intronic
1001491643 5:172160175-172160197 CTGGCTAGGGGCCATTTTGTAGG - Intronic
1002752667 6:131959-131981 CTTGCTAAGAGCAATCTTGAAGG - Intergenic
1005009471 6:21322387-21322409 CTGGCCAATGGTCTTTTTGAAGG + Intergenic
1005997681 6:30941226-30941248 CTGGCTAAGGGACATGTAGTAGG + Intronic
1007720282 6:43881070-43881092 TTGGCTAAGGGTCACTTTGGAGG + Intergenic
1008070552 6:47095050-47095072 CTAACTAAGGGCCATCTTGAAGG - Intergenic
1009667443 6:66702864-66702886 CTGGCTAAGGGCCATTCCCCGGG + Intergenic
1011416115 6:87121960-87121982 CTGGCTCAGAGCCATTCTCATGG + Intergenic
1012310609 6:97719868-97719890 ATAGCTAAGGGCAATTTTTAGGG - Intergenic
1017802259 6:157907840-157907862 TTGGCTAAGGCCCAATTTCACGG - Intronic
1018995541 6:168707099-168707121 CAGGAGAAGGGCCATCTTGAAGG - Intergenic
1020367797 7:7399121-7399143 GTGGCTAAGGTGTATTTTGATGG - Intronic
1024345224 7:48306446-48306468 TTGGATGAGGTCCATTTTGAGGG + Intronic
1027515501 7:79137321-79137343 CTCTCTAATGGCCATTCTGAGGG + Intronic
1028110704 7:86937543-86937565 CTGGCTATGTGCCATTTATATGG + Intronic
1028436965 7:90815225-90815247 CTGGTTTAGTTCCATTTTGATGG - Intronic
1028445184 7:90913945-90913967 ATGTCAAAGTGCCATTTTGAGGG + Intronic
1029570883 7:101368339-101368361 CTGGCTAAGCCCCAATTTGGGGG - Intronic
1029716011 7:102326322-102326344 CTGGCTTAGGGCCTTTTAGGGGG - Intergenic
1029940856 7:104479281-104479303 CTCTCTAATGGCCATTCTGAGGG + Intronic
1032886344 7:136143368-136143390 CTTACTGAGGGCAATTTTGATGG - Intergenic
1034063731 7:148117238-148117260 CTGGCTGAGAGCCATTTGGTGGG + Intronic
1035866194 8:3084759-3084781 CTGGATAAAGGCCATTGGGAAGG - Intronic
1035970301 8:4240362-4240384 CTGGCTATGCCCCATTTTGCAGG + Intronic
1037592194 8:20322381-20322403 CTGTCCCAGGGCCATTCTGAGGG + Intergenic
1040413853 8:47180755-47180777 CTGGCTAAGGGACGTTGAGAAGG + Intergenic
1041905368 8:63027070-63027092 GAGGCTAAGGGTAATTTTGAAGG + Intronic
1043184627 8:77131089-77131111 CTGCCTTAGGGCAATTGTGAGGG + Intergenic
1057131918 9:92660027-92660049 CTGGCTAAGGATCATTTTAATGG + Intronic
1059585842 9:115605411-115605433 CTGGGTCAGGGCCATATTTAAGG + Intergenic
1059705719 9:116821505-116821527 CTGGCTAGGAGCCCTTTTCATGG - Intronic
1062720318 9:138038538-138038560 CTGGCTAAGTGCCACCTTGGGGG - Intronic
1185754937 X:2645674-2645696 CAGTCAAAGGGCCATTTTCAAGG + Intergenic
1186499661 X:10041157-10041179 CTGGCCAGGGGCCATTTCGATGG - Intronic
1190832639 X:54073145-54073167 CTGGATAAGGCACATTGTGATGG + Exonic
1194339761 X:92693869-92693891 CTGGGTTAGGACCATTTTCAGGG + Intergenic
1194844232 X:98783646-98783668 AAGGCAAAGGGCCCTTTTGAAGG + Intergenic
1195921651 X:109989780-109989802 CATGCTAAGGGCCAATCTGAGGG + Intergenic
1197446318 X:126554679-126554701 CTGGATAAGGCCCATTTTCAGGG - Intergenic
1200648145 Y:5810652-5810674 CTGGGTTAGGACCATTTTCAGGG + Intergenic
1200939309 Y:8765669-8765691 CTGGCTAAATCCCAATTTGAGGG - Intergenic