ID: 988893651

View in Genome Browser
Species Human (GRCh38)
Location 5:35648295-35648317
Sequence CAGATAAAAGCCTCTGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988893651 Original CRISPR CAGATAAAAGCCTCTGTAGG TGG (reversed) Intronic
901016164 1:6232541-6232563 AAAATAAAAGCCTCCGTATGTGG - Intronic
903726332 1:25448870-25448892 CAAAAAAAAGCCACTGTATGGGG - Exonic
904892197 1:33787889-33787911 CAGATAAACACCACTGTTGGTGG - Intronic
910772017 1:90840380-90840402 CAGTGAAAACCCTCTGAAGGTGG + Intergenic
915754275 1:158243787-158243809 TATATAAAAGCCTCTCTAGCTGG - Intergenic
920527812 1:206681051-206681073 CATATAAAAGTCTGGGTAGGTGG + Intronic
920594249 1:207252646-207252668 CAGATAAAAGCCATTTTAGCTGG + Intergenic
920980444 1:210829421-210829443 TTGATAATAGACTCTGTAGGGGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922046144 1:221948203-221948225 CACAAAAAAGCCTGTTTAGGTGG + Intergenic
924054534 1:240112495-240112517 CAAATAAAAGACTCAGTGGGAGG - Intronic
1064723727 10:18256581-18256603 CAGATCCAAGCCTGTGGAGGAGG - Intronic
1066217567 10:33302514-33302536 CAGATGAGATCCTCTGTTGGAGG + Intronic
1067131881 10:43572776-43572798 CCCATAAAACCATCTGTAGGAGG - Intronic
1072334209 10:94383211-94383233 CACATAAAAGACTCTAGAGGGGG + Intergenic
1077698073 11:4413258-4413280 CATACAAAGGCCTCTGTACGAGG + Intergenic
1080978608 11:37373763-37373785 CCCAGAAAAGCCTCTGCAGGAGG + Intergenic
1083126212 11:60568597-60568619 CTGATAAAAGCCACTGCAGGTGG - Intergenic
1084500325 11:69531278-69531300 CAGCTCAAAGCCTGGGTAGGAGG + Intergenic
1090237379 11:125159555-125159577 CAGATAAGAGGATCTGTGGGTGG - Intergenic
1094551969 12:31461161-31461183 AAGAAAAAAGCCTCTGATGGAGG - Intronic
1096438994 12:51622804-51622826 TAGATAATACCCTCTGTAGGAGG - Intronic
1099341816 12:81446717-81446739 CAGATATAAGACACTGAAGGTGG + Intronic
1100577969 12:95910161-95910183 CAGATCTAAGCCTCTTTTGGTGG - Intronic
1103640542 12:122348036-122348058 CAAATAAAAACCTCAGTAGAAGG + Intronic
1107761979 13:43689087-43689109 CAGAGACAAGCATTTGTAGGAGG + Intronic
1108127557 13:47261079-47261101 AAGATAAAAGTCTGCGTAGGTGG - Intergenic
1108596960 13:51957726-51957748 ACGATAAAAGGCTCTGCAGGTGG + Intronic
1114579766 14:23746847-23746869 CATATAAAAGCCTCTTTGGAAGG + Intergenic
1116316069 14:43393827-43393849 CAGATAAAAGCATTTTTAGGGGG - Intergenic
1117236988 14:53788488-53788510 CAGATATAAGTCTATGTATGTGG - Intergenic
1117840447 14:59855333-59855355 TTTATAAAAGCCTCAGTAGGTGG - Intronic
1121401557 14:93682671-93682693 CAGATGATAGCCTCTGTACCTGG + Exonic
1122385938 14:101348346-101348368 CAGCCAGAAGCCTCTGTAGTCGG + Intergenic
1127624146 15:60763793-60763815 AAAATAAAAGCCTCCGGAGGTGG - Intronic
1128242584 15:66111012-66111034 CAGAGAAAACCCACTGTAGGAGG + Intronic
1132730802 16:1360900-1360922 CAGATAAAAGCTTCAGGAGTTGG - Intronic
1140209811 16:72961109-72961131 CAGATAGAAGCTGCTGGAGGGGG - Intronic
1145280583 17:21464288-21464310 CAGCTAAAAGCCACTGTGGGGGG + Intergenic
1145397314 17:22506227-22506249 CAGCTAAAAGCCGCTGTTGGGGG - Intergenic
1146520324 17:33521199-33521221 CAAATAAAGGCCTCTGGAGCTGG + Intronic
1150011326 17:61507095-61507117 CAGAGAAAAACCTGTGCAGGAGG + Intergenic
1157601820 18:48897545-48897567 AAGATGAAAGCCTGTGGAGGAGG + Intergenic
1158840412 18:61380129-61380151 CAGATAAAACCCCCTGAAGGGGG + Intronic
1162199160 19:9008746-9008768 CAGTAAACAGCCTCTGTTGGTGG + Intergenic
1162773502 19:12965012-12965034 CAGAAAAAAGCCTCAGGAGGAGG - Intergenic
1162819848 19:13216059-13216081 CAGATGAAAGCCACTGTGCGTGG + Intronic
1167490626 19:49790944-49790966 GAGATGAAAGCCGCTGTGGGTGG - Intronic
926227672 2:10979689-10979711 GAGAGAAGAACCTCTGTAGGAGG - Intergenic
928784563 2:34866961-34866983 AAGATAAAAGCATCAGTAGTGGG + Intergenic
929246663 2:39709802-39709824 TGGACAAAAGCCTCAGTAGGAGG + Intronic
932169163 2:69538118-69538140 CAGATTCAACCATCTGTAGGTGG - Intronic
932735659 2:74252335-74252357 CAGATGAATGGCTCTGTGGGAGG - Exonic
932915377 2:75852675-75852697 GAGAAAAAAGCCTTTGAAGGGGG + Intergenic
935312494 2:101799238-101799260 CTGACAAAAGCCTCTGAAGTAGG - Intronic
939365497 2:141225107-141225129 AAGATAAAAGCCTGTGAATGGGG + Intronic
940756118 2:157685057-157685079 CAACTTAAAGCCACTGTAGGAGG - Intergenic
940956801 2:159737911-159737933 CAGCTAGAAGCCTCTGTGGCTGG + Intronic
942779451 2:179623943-179623965 CAGATGAAAGCCCCTTTAGAAGG - Intronic
946650056 2:221883599-221883621 CAGAAGACAGCCTCTGTGGGTGG + Intergenic
946650192 2:221885130-221885152 CAGATGAGAGGCTCTGTAGCAGG + Intergenic
1169633360 20:7659245-7659267 CAGACAAAAGCCTCTTTGTGTGG + Intergenic
1170199206 20:13724380-13724402 CAGATATAAGGATCTGTAGTAGG - Intronic
1170842495 20:19935322-19935344 TAGATGAAATCCTCTGTAGGAGG + Intronic
1174713175 20:52728533-52728555 CAGACAAACGTCTCTGTGGGGGG + Intergenic
1179328792 21:40378346-40378368 GAAATAAAAACCTCTATAGGTGG + Intronic
1181995104 22:26871681-26871703 AAGATAAAAAACACTGTAGGGGG - Intergenic
950063908 3:10095627-10095649 CAGATGAAAGCCTCTACAGATGG - Intronic
950821566 3:15765543-15765565 CATATAATACCCTATGTAGGCGG + Intronic
964750812 3:160052204-160052226 CAGATAAAAATCACTGAAGGAGG - Intergenic
967223026 3:187265236-187265258 CAGAAAGAAGCCTGTGTAGCTGG - Intronic
967295180 3:187957392-187957414 CAGATGAAATGCTCTGAAGGTGG - Intergenic
971702518 4:29997102-29997124 CAGATAAAAGCATCAGTATTGGG - Intergenic
972764596 4:42140877-42140899 CTGATGAAAGTCTCTGTAGCTGG + Intronic
975591425 4:76003964-76003986 CAGCTACAACCCTCTGAAGGTGG + Intronic
980953737 4:139407610-139407632 CAAATACAAGCCTCTACAGGTGG - Intronic
981136799 4:141220211-141220233 GAGATAAAAGCCTCTTTATTTGG - Intergenic
983715459 4:170776497-170776519 CAGATAGAAGACTCTGGAGTGGG - Intergenic
984340751 4:178453087-178453109 CATATAAAGGCCCGTGTAGGAGG - Intergenic
984408493 4:179365599-179365621 CAGTTAAAAATCTCTGGAGGAGG + Intergenic
985206789 4:187546858-187546880 CAGATAAAAGGCTCTGTATGTGG - Intergenic
985221764 4:187713706-187713728 CAGATATAAGCCTCTGTGCCCGG + Intergenic
986019462 5:3787626-3787648 CAGAGAATAGTTTCTGTAGGGGG - Intergenic
986167429 5:5287439-5287461 GAGGTATAAGCCTCTGTAGATGG - Intronic
988206370 5:28141615-28141637 CAGAAAAAAGCCTTTGTCAGAGG + Intergenic
988893651 5:35648295-35648317 CAGATAAAAGCCTCTGTAGGTGG - Intronic
989605167 5:43237373-43237395 CAGATCAAAGCCTCTGGAGCAGG - Intronic
990679956 5:58231345-58231367 TGGATAAATGCCACTGTAGGAGG + Intergenic
992939379 5:81749095-81749117 CTGATAAAAACATCTGAAGGAGG - Intronic
993051214 5:82928251-82928273 CAGATGAAAACCCCTGGAGGTGG + Intergenic
994723860 5:103411852-103411874 CAGATCAAAGCCTCTCTTAGTGG - Intergenic
996197389 5:120625613-120625635 CAGGTAAAAGCCACTGTGTGTGG + Intronic
997829229 5:137134730-137134752 CAGTTCAAAGCCCCTGTAGCAGG + Intronic
999420745 5:151440372-151440394 GAGTTAGAAGCCACTGTAGGGGG + Intronic
1000230837 5:159313796-159313818 CAGATGAAAGACCCTGTAGGGGG + Intergenic
1000998103 5:167979371-167979393 AAGATAAACTGCTCTGTAGGTGG + Intronic
1002355971 5:178628855-178628877 AATATAAAGGCCTCTGTAGGTGG - Intronic
1003741040 6:8940105-8940127 CAGATAAAACTCTCTTTAAGTGG - Intergenic
1008387620 6:50911954-50911976 CAGATAAAATTCTATGTATGTGG + Intergenic
1012334560 6:98039272-98039294 CACATAATAGCCTCTGTGGTAGG + Intergenic
1012491447 6:99787179-99787201 AAGATAAAAGACTCTGTGGAAGG - Intergenic
1012667474 6:101992364-101992386 TAGATAAAAGCCTATTTAGTGGG + Intronic
1012901819 6:105014728-105014750 CAGATATAAGCCACTGTACCTGG + Intronic
1014931769 6:127344338-127344360 AGGATAAAATCCTCCGTAGGAGG - Intergenic
1017291240 6:152740686-152740708 CAGATGAAATCCTTTTTAGGTGG + Intergenic
1017797598 6:157860613-157860635 CAGATCAAAGCTTCTATATGCGG - Intronic
1018092229 6:160355334-160355356 GAGGGAAAAGCCTCTATAGGCGG - Intronic
1018261703 6:161976915-161976937 CAGATAAAAGCCTTTTTATTGGG + Intronic
1022370802 7:29769624-29769646 CAAATAAAGGTTTCTGTAGGGGG - Intergenic
1024843131 7:53610910-53610932 CAGACAAAAGCTACTGCAGGGGG - Intergenic
1027124170 7:75544182-75544204 AAAAAAAAAGCCTCTGTAAGAGG + Intronic
1027460021 7:78440605-78440627 CATATAAAAGTATATGTAGGGGG + Intronic
1028113996 7:86976699-86976721 CTTATAAAATCCTCTGTAGACGG - Intronic
1030608909 7:111667919-111667941 CAGATATGGGCCTCTTTAGGAGG - Intergenic
1035316921 7:158002241-158002263 CAGAGCACAGCCTCTGCAGGGGG - Intronic
1038264291 8:26025696-26025718 AAGATAAAGGACTCTGTAGCTGG - Intronic
1040583932 8:48722241-48722263 GTGATAATAGCCTCTGTAAGAGG - Intronic
1041405103 8:57490413-57490435 CAGATAAAAGTCTCTGCTGGAGG + Intergenic
1043471965 8:80572059-80572081 CAGACACAAACCTCAGTAGGAGG + Intergenic
1046821963 8:118643607-118643629 CAGACAAAAGTATCTGTAGAAGG + Intergenic
1049308130 8:141918577-141918599 CAGCTTAAAACCTCTGCAGGGGG + Intergenic
1055703493 9:78972311-78972333 GAGATAAAAGCCCTTGTAAGGGG - Intergenic
1058487530 9:105457608-105457630 CAGCTAGAAACCTCTGTAGCTGG + Intronic
1059687756 9:116653853-116653875 CAGATCAAAGGCTCTGGGGGAGG + Intronic
1061949256 9:133927072-133927094 CTGATAAGAGCATGTGTAGGGGG - Intronic
1195067355 X:101249745-101249767 CAGAGAATAACCTCTGGAGGAGG + Intronic
1196399894 X:115303714-115303736 AAGCTCAAAGCCTCTGTATGAGG - Intronic