ID: 988894529

View in Genome Browser
Species Human (GRCh38)
Location 5:35657618-35657640
Sequence TGTAGGATCATCAACTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988894526_988894529 7 Left 988894526 5:35657588-35657610 CCTAATGTCTTAGATCACAGAGT 0: 1
1: 0
2: 1
3: 24
4: 169
Right 988894529 5:35657618-35657640 TGTAGGATCATCAACTGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 147
988894525_988894529 8 Left 988894525 5:35657587-35657609 CCCTAATGTCTTAGATCACAGAG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 988894529 5:35657618-35657640 TGTAGGATCATCAACTGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988894529 Original CRISPR TGTAGGATCATCAACTGAGA TGG Intronic
900588057 1:3443057-3443079 TGCAGGCTCATCTGCTGAGATGG - Intergenic
900759092 1:4458919-4458941 TCTGGGAACATCAAATGAGAAGG - Intergenic
901715694 1:11151998-11152020 TGTAGGAACAGCAACTCAGAAGG + Intronic
902640734 1:17764640-17764662 TGGAGGATCATCAACAGCGTGGG - Intronic
904855689 1:33496743-33496765 TATATGGTCATCTACTGAGAGGG + Intergenic
906234950 1:44200692-44200714 TGGAGTATCATCAACAGTGAAGG - Intergenic
908471693 1:64450526-64450548 TATAGGAGCATCATCAGAGAAGG - Intergenic
908959103 1:69672752-69672774 TCTAGAATCATGGACTGAGATGG - Intronic
911152230 1:94606892-94606914 CGTAGCATCCTCAACTGAAAGGG - Intergenic
912670014 1:111616797-111616819 TGTATGATCATCAACTCAAGAGG + Intronic
913529388 1:119722776-119722798 TGTAGTCTCAGCTACTGAGAAGG + Intronic
917357245 1:174139528-174139550 AGCAAGATCATCAGCTGAGAGGG - Intergenic
918149966 1:181789905-181789927 TGTTGGTTCATGAACTGAGAAGG - Intronic
918543364 1:185655427-185655449 TGCAGGATCATGAACTGTGGGGG - Intergenic
918648318 1:186928009-186928031 TATAGGAACATGAACTGAGCAGG + Intronic
918886417 1:190199961-190199983 TGCAGTATCATAAACTAAGAGGG - Intronic
921239518 1:213164431-213164453 TGTATGATCAGAAATTGAGAAGG + Intronic
922876183 1:228941487-228941509 GGTAGGGTCACCAAATGAGATGG - Intergenic
1063548860 10:7009235-7009257 TGTAAGAGCATCAGCTGCGATGG - Intergenic
1064151638 10:12870609-12870631 AGGAGCATCAGCAACTGAGAGGG - Intergenic
1064434990 10:15303583-15303605 TGTAGCATTATGAATTGAGATGG - Intronic
1069027211 10:63555845-63555867 TGTAAAATAATCAACTGGGAAGG - Intronic
1070840136 10:79480121-79480143 TGTAGTATCAGCTACTCAGAAGG + Intergenic
1074436689 10:113440355-113440377 TGTTGCATCATCCACTGAAAGGG - Intergenic
1074971347 10:118542098-118542120 TTTAGGAACATCAACTGATAAGG - Intergenic
1076403614 10:130198137-130198159 TGGAGGAGCATCAACTGGGGGGG + Intergenic
1078801894 11:14653901-14653923 TGTGGGAGCATCACCTGAGCTGG + Intronic
1083142288 11:60732136-60732158 TGTAGGAGCCCCAAATGAGAGGG + Intronic
1086253231 11:84842747-84842769 TTTAGGATCATTAAAGGAGAGGG + Intronic
1088428855 11:109734910-109734932 TGTAGGAACATGACCTGAAATGG + Intergenic
1089407757 11:118212649-118212671 TGTTGGATCATCCAGGGAGAGGG - Intronic
1090724188 11:129508230-129508252 TGTAGGCTCAGCTACTCAGAGGG + Intergenic
1097644097 12:62215321-62215343 TGTTGGAGCAACTACTGAGAAGG - Intronic
1100738417 12:97563902-97563924 TGAAAAATCATCAACTAAGAAGG + Intergenic
1101690161 12:107071028-107071050 TCTAGGAGAATCAACTGAAAAGG - Intronic
1104574175 12:129951573-129951595 TTTAGGATGATCAACTGGGCTGG + Intergenic
1104652140 12:130543041-130543063 GGTTGGATGATGAACTGAGAAGG + Intronic
1108227767 13:48306281-48306303 TGTAGGCTCATCTACTCAGGAGG + Intronic
1108678525 13:52759645-52759667 GGTAGGATCATGATCTGATATGG + Intergenic
1110302650 13:73947527-73947549 TGTAGTATCAGCTACTGAGGAGG + Intronic
1119573655 14:75698781-75698803 TGTAGTCCCATCAACTCAGAAGG + Intronic
1120794961 14:88622670-88622692 TGTGGGATCAGGAACTGAGGCGG - Exonic
1126667065 15:51084944-51084966 TGCAGGAGGAGCAACTGAGAAGG + Intronic
1126735510 15:51728526-51728548 TGTATAATCAGCAAATGAGAAGG + Intronic
1128371962 15:67046723-67046745 TGTAGGCCCAGCAACTCAGAAGG - Intergenic
1128806962 15:70538335-70538357 TGGAGGATAATAGACTGAGAGGG - Intergenic
1129054620 15:72810149-72810171 TGGAGGAGGATCAACTGGGAGGG + Intergenic
1130261356 15:82356147-82356169 AGTAGGATCATTAAATGTGACGG - Intergenic
1130279879 15:82512864-82512886 AGTAGGATCATTAAATGTGACGG + Intergenic
1130471254 15:84229050-84229072 AGTAGGATCATTAAATGTGACGG + Intergenic
1130478748 15:84343621-84343643 AGTAGGATCATTAAATGTGACGG + Intergenic
1130493022 15:84444511-84444533 AGTAGGATCATTAAATGTGACGG - Intergenic
1130551465 15:84892328-84892350 AGTAGGGTCATCTGCTGAGATGG + Intronic
1130593549 15:85233687-85233709 AGTAGGATCATTAAATGTGACGG + Intergenic
1131318045 15:91358098-91358120 TCTTGGCTCATCAACTGTGAGGG + Intergenic
1131429374 15:92374528-92374550 TGTGGCACCATTAACTGAGATGG + Intergenic
1132006764 15:98234363-98234385 TGTAGGCTTATGAGCTGAGAAGG + Intergenic
1133419271 16:5631860-5631882 TGTAGGATCATTTTCTGGGATGG + Intergenic
1139533064 16:67552969-67552991 TGTAGCATCAGCTACTGAGGAGG + Intergenic
1140294589 16:73695915-73695937 TGTAGGAGCAACAAAGGAGAGGG + Intergenic
1141981733 16:87554733-87554755 TGTGGGATCATCAAAAGAGATGG + Intergenic
1144802997 17:17944005-17944027 TGTAGCAGCATGCACTGAGAGGG - Intronic
1147053117 17:37812899-37812921 TGAAGGATTTTCAACAGAGAGGG - Intergenic
1147583984 17:41642309-41642331 TAAAGGATTATCAATTGAGAAGG - Intergenic
1148242705 17:46010919-46010941 TGTAGGAGCAGCAGCTGAGCAGG - Intronic
1150348143 17:64420668-64420690 TGTAGGCTCATCTACTCAGGAGG + Intergenic
1151241957 17:72765067-72765089 TGAAGGATCATCAAATTAGGAGG + Intronic
1156146451 18:34187003-34187025 GGTAGATTCATCAACTGTGATGG - Intronic
1163969064 19:20775052-20775074 TGGAGGATTACCAACTGAGTAGG + Intronic
1167894284 19:52568798-52568820 TGTAGGAGCCTCACCAGAGAGGG + Intronic
1167898318 19:52599807-52599829 TGTAGGAGCCTCACCAGAGAGGG + Intronic
1167994783 19:53393627-53393649 TGTAGGAGCCTCACCAGAGAGGG + Intronic
1167999049 19:53430461-53430483 TGTAGGAGCCTCACCAGAGAGGG + Intergenic
926956497 2:18306894-18306916 TGTAGGTCCATCAACTGTGGGGG - Intronic
929462161 2:42110594-42110616 TGCAGAATCTTCTACTGAGAAGG - Intergenic
930722629 2:54652604-54652626 AGTAGGATCATAAAATCAGAAGG + Intronic
932499452 2:72170681-72170703 TGTAGCATCAGCTACTCAGAAGG + Intergenic
933567731 2:83971480-83971502 TGTGGTGTCATTAACTGAGATGG + Intergenic
937352892 2:121178062-121178084 GGTAGGATCATCACCTGCCATGG + Intergenic
939106767 2:137957634-137957656 TGGAGGATAATTAATTGAGAAGG - Intergenic
940966176 2:159839492-159839514 TCTAGGATCAGCACTTGAGATGG + Intronic
941234830 2:162958427-162958449 TATAAGATCATGAACTGAGATGG - Intergenic
943083265 2:183282149-183282171 TATAGGATAGTCAACTGAGAAGG + Intergenic
945015282 2:205508646-205508668 AGAAGGTTCATCAACTGAGAAGG - Intronic
946462475 2:219881370-219881392 TGTAGTCCCAGCAACTGAGAGGG + Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1178394991 21:32235235-32235257 TGGAGGATCTTCACCTGAGGCGG + Intergenic
1178724084 21:35035930-35035952 TGTTTGATCCTAAACTGAGAGGG + Intronic
1184392239 22:44210796-44210818 TGTAGCCCCAGCAACTGAGAAGG - Intronic
1185207342 22:49547682-49547704 TATATGAGCATCAAATGAGAAGG - Intronic
949228672 3:1724624-1724646 TGAAGGATCATTAATTAAGAAGG + Intergenic
951425191 3:22536541-22536563 TGTAGGATCTTAAAGTTAGAAGG - Intergenic
952436069 3:33273834-33273856 TGTAGTCTCAGCTACTGAGAAGG + Intergenic
953090933 3:39725642-39725664 TGTAGGAGAATCTATTGAGAAGG + Intergenic
953648658 3:44779214-44779236 TGTAGCATCATAAAGTAAGAAGG - Intronic
953852989 3:46480000-46480022 GGTAGTTTCATTAACTGAGATGG + Intronic
960571887 3:119192571-119192593 GGTCGGGTCATCAACTGAGAGGG - Intronic
961794620 3:129400906-129400928 AGTGGGTTCATCAACTGGGAGGG + Intergenic
964706749 3:159626705-159626727 TGTAGAATCCTCACATGAGAAGG - Intronic
966626823 3:182025886-182025908 TGGAGGATCATCAATAGACAAGG - Intergenic
966752149 3:183332474-183332496 TGTAGATGCATCACCTGAGAAGG + Intronic
970262834 4:14246975-14246997 TGTAGAATAAGCAAATGAGAGGG - Intergenic
974757369 4:66227893-66227915 TCAAGTATCATAAACTGAGAAGG - Intergenic
975523021 4:75320436-75320458 TCTGGGGTCATCTACTGAGATGG - Intergenic
977476853 4:97521851-97521873 TGTAGTATCAGCTACTGGGAAGG + Intronic
978573166 4:110162466-110162488 TGTAGTCTCAACAACTCAGAAGG - Intronic
978905291 4:113998052-113998074 TGCAGAATCATGAACAGAGAGGG - Intergenic
981396076 4:144251505-144251527 TGTATGATGAACAACAGAGAGGG - Intergenic
986986684 5:13508174-13508196 TGCAGGATCCACAACAGAGAAGG + Intergenic
988894529 5:35657618-35657640 TGTAGGATCATCAACTGAGATGG + Intronic
990568671 5:57055678-57055700 TGCAGGATCATCAAAGGAGTTGG - Intergenic
990714582 5:58622630-58622652 AGTAGTATCATCAAATGAGGAGG - Intronic
991431940 5:66557485-66557507 TGTAGTATCAGCTACTCAGAAGG - Intergenic
992668255 5:79032827-79032849 TTTAGGATAACCAACTGAAAAGG + Exonic
994665786 5:102703784-102703806 TGTATGGTCATCCACTTAGAAGG - Intergenic
997723017 5:136095649-136095671 TGTAGGATAAACAACTACGAGGG - Intergenic
1000785343 5:165536071-165536093 AGTATGATCATCAACTCTGAAGG + Intergenic
1002062389 5:176633353-176633375 TGTAGTCTCATCTACTGAAAGGG - Intronic
1008134776 6:47761830-47761852 TGTAGGTTCATCAATTGTAAAGG - Intergenic
1009038961 6:58154659-58154681 TGTAGTATCAGCTACTGAGAAGG - Intergenic
1009214856 6:60909495-60909517 TGTAGTATCAGCTACTCAGAAGG - Intergenic
1011125489 6:84002912-84002934 TGCAGGATCCTTACCTGAGAAGG - Intergenic
1012453079 6:99374316-99374338 TGCAGGGTCAGCACCTGAGAGGG + Intronic
1015786702 6:136926021-136926043 GGTAGGATGATCACCTGAGCCGG + Intergenic
1019991359 7:4694000-4694022 TGTAGTATCAGCTACTCAGAAGG - Intronic
1020152134 7:5690736-5690758 TGCAGGAGCATCAGCAGAGAAGG - Intronic
1026125443 7:67575508-67575530 TGTAGTCTCATCTACTCAGAAGG - Intergenic
1030743497 7:113137748-113137770 TGTAGTATCCCCAACTGACAGGG - Intergenic
1031558157 7:123204319-123204341 TGAATGCTCATGAACTGAGAAGG + Intergenic
1031716258 7:125112466-125112488 TTTAGTATCATCAAATGATATGG + Intergenic
1036839085 8:12101751-12101773 TGCAGGATCATGAATGGAGATGG - Intergenic
1036860874 8:12347994-12348016 TGCAGGATCATGAATGGAGATGG - Intergenic
1038996595 8:32929815-32929837 TGGAGTTGCATCAACTGAGATGG - Intergenic
1041739228 8:61140342-61140364 TTCATGATCATCAAATGAGACGG - Intronic
1042907917 8:73792743-73792765 TGTAGTATCATTAACTCACATGG + Exonic
1043532172 8:81163123-81163145 TGTAGGTTCATTAACTGTAATGG - Intergenic
1044567673 8:93682544-93682566 TGTAGGATCAGCTACTGGGGAGG + Intergenic
1044638128 8:94348609-94348631 TGTAACATCAACAACTGAAAGGG + Intergenic
1045203719 8:100014724-100014746 TGTAGGGGCATGAACTGAGAAGG - Intronic
1045707620 8:104944464-104944486 TGTAGCATGAGCATCTGAGATGG - Intronic
1045936887 8:107690265-107690287 TGTAATCTCATCAGCTGAGATGG - Intergenic
1047657427 8:126993217-126993239 TGTAGTCTCATCAGCTCAGAAGG + Intergenic
1052343405 9:27384796-27384818 AGTAGCATCAGGAACTGAGACGG + Intronic
1055026529 9:71728358-71728380 TGTAGTATCAGCTACTCAGAAGG + Intronic
1059381906 9:113933595-113933617 TCTAGGATCATGAATTGAGGAGG + Intronic
1059997504 9:119926504-119926526 TGTATCCTCATCAACTTAGAAGG - Intergenic
1060292233 9:122314615-122314637 TGTATGAGAATCACCTGAGAAGG - Intronic
1060562238 9:124555492-124555514 TGTAGTCTCATCTACTGAGGAGG + Intronic
1061325327 9:129860600-129860622 TGTAGTCTCAGCTACTGAGAAGG + Intronic
1186328620 X:8508200-8508222 TGAAGGGTTATCATCTGAGATGG - Intergenic
1188149744 X:26657179-26657201 TAAAGGAACATCAACTGACACGG - Intergenic
1189233131 X:39467537-39467559 TGTAGTACCAGCAACTCAGAAGG + Intergenic
1194123163 X:89985366-89985388 TGTATGATCATGAAATTAGAAGG + Intergenic
1195888201 X:109663832-109663854 GGTAGCATCATAAAGTGAGAGGG + Intronic
1198505532 X:137297449-137297471 TTTAGGAGCTTCAACTGAGTAGG - Intergenic
1199878765 X:151956091-151956113 TGTAGGACAGTGAACTGAGAAGG - Intronic
1201433687 Y:13932745-13932767 TGAAGGGTTATCATCTGAGATGG + Intergenic
1202042329 Y:20698300-20698322 TGCAGGCCCATCAACAGAGAAGG + Intergenic