ID: 988895640

View in Genome Browser
Species Human (GRCh38)
Location 5:35670806-35670828
Sequence TTAGGTGACCAGTTCATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988895636_988895640 -2 Left 988895636 5:35670785-35670807 CCAACTACTAACTGTGTGACCTT 0: 1
1: 6
2: 58
3: 436
4: 2017
Right 988895640 5:35670806-35670828 TTAGGTGACCAGTTCATTAAGGG 0: 1
1: 0
2: 1
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988895640 Original CRISPR TTAGGTGACCAGTTCATTAA GGG Intronic
900504128 1:3020748-3020770 AGAGGTGACCAGGCCATTAAAGG - Intergenic
908164782 1:61447344-61447366 TTAAGTTACAAATTCATTAAAGG - Intronic
909646766 1:77925244-77925266 TTAGGTGAATGTTTCATTAAAGG - Intronic
911282377 1:95946598-95946620 TTAGGTGACCAGATTAGCAATGG - Intergenic
915870413 1:159554139-159554161 TTAAGTGACAAGATAATTAAGGG - Intergenic
924662298 1:246032320-246032342 TTAGGTGACCTGATCATGACAGG - Intronic
1071175242 10:82918579-82918601 TTACGTGGCAAGTTGATTAATGG + Intronic
1072470935 10:95712486-95712508 TTAGGTGACCAGTCTAAAAATGG + Intronic
1074548982 10:114425901-114425923 TTAGGTGCACAGTTGCTTAAAGG - Intergenic
1079882907 11:25948672-25948694 TTCGATGCCCAGTTCATTGAGGG - Intergenic
1080045172 11:27800585-27800607 TAATGTGACCAGTCCATGAATGG + Intergenic
1080236695 11:30077834-30077856 TTGGGTCACCAGTGCCTTAAAGG - Intergenic
1084765527 11:71305768-71305790 TTACGTGACCAGGTCACTTAGGG + Intergenic
1087139764 11:94753899-94753921 TTAAGTTACCAGTTCTTTGAGGG - Intronic
1087915487 11:103804878-103804900 TTAGATGATGAGTTCCTTAAAGG + Intergenic
1089039526 11:115433461-115433483 TTATGTGACCATTTCTTTCAGGG + Intronic
1092522050 12:9285391-9285413 TTAAATGGCCAGTTCTTTAATGG - Intergenic
1092545232 12:9446465-9446487 TTAAATGGCCAGTTCTTTAATGG + Intergenic
1093387803 12:18580919-18580941 TTGGCTGACCAGTTAATAAATGG + Intronic
1094507716 12:31075584-31075606 TTAAATGGCCAGTTCTTTAATGG - Intronic
1108056689 13:46492229-46492251 TTAGGTTTCCATTACATTAAGGG + Intergenic
1109573420 13:64222367-64222389 TTAGGAGACAAGTTTATTATTGG - Intergenic
1111632549 13:90861055-90861077 CTACGTGACAAGTTCAATAAAGG + Intergenic
1117739971 14:58807043-58807065 ATATTTGACCAGCTCATTAATGG + Intergenic
1127338452 15:58014499-58014521 TTAGTTGACAGGTTCATGAAAGG - Intronic
1128370940 15:67038814-67038836 TTAAGTGACCAGTTTAGTTAGGG + Intergenic
1131610722 15:93959254-93959276 TTAGGTAACCAGTGCTTGAAGGG - Intergenic
1133886951 16:9838963-9838985 TTAGGTGACAGGTACACTAAAGG + Intronic
1135513582 16:23110602-23110624 TTAATTTACCAGTTCATTTACGG - Intronic
1138912192 16:61414574-61414596 TTAGGTCATTAGTTCATGAAGGG - Intergenic
1146134734 17:30309301-30309323 TGAGTTGAGCAGTTCATTAGTGG + Intergenic
1151616272 17:75214414-75214436 TTAGGGGAACAGTCTATTAACGG - Intronic
1154968715 18:21385464-21385486 TTAAGTGCCCAATTCACTAAAGG + Intronic
1155816787 18:30321483-30321505 TTAGGTGCTCAGTTTCTTAAAGG + Intergenic
1157326547 18:46673172-46673194 TTAAGTGTACAGTTCAGTAATGG - Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165179217 19:33953373-33953395 ATTGGAGACCAGTTCTTTAATGG + Intergenic
933774384 2:85763090-85763112 TTAGGTGAACAGTACATCATAGG + Intronic
938375849 2:130806057-130806079 TTAGGTGTGCAGTTCAGTAGTGG - Intergenic
939581203 2:143948130-143948152 TAAGGTGACCAGTTTCTTGAAGG + Intronic
948313722 2:237010645-237010667 TTAGGTGTCGACTGCATTAAGGG - Intergenic
1171184210 20:23113223-23113245 TAAGGTGACCAGTGCAATGAAGG - Intergenic
1182884738 22:33763745-33763767 TTTGGTAAGCACTTCATTAAAGG - Intronic
952850902 3:37728566-37728588 TTAGGGGAGCACTTCATTCAAGG - Intronic
954036849 3:47855367-47855389 CTAGGTGACCAGTTCCTTTGTGG - Intronic
959676778 3:109044710-109044732 TGAGGTGAGCAGCTCATTCAAGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959949825 3:112166645-112166667 TTAATTGATCAATTCATTAAAGG - Intronic
962140682 3:132787506-132787528 TTTGATGTCCAGTTCATTGAGGG + Intergenic
964392727 3:156214157-156214179 TTACTTTACCAGTTTATTAAAGG - Intronic
967279602 3:187808987-187809009 TTAGATGACCAGTTCTTCACAGG + Intergenic
971217918 4:24678800-24678822 TTTTGTGCCCAGTTAATTAATGG - Intergenic
971379932 4:26087333-26087355 TCAAGTGACCAGTTAATGAAGGG - Intergenic
971408995 4:26350599-26350621 ATAGGTGAACAGTTCATTAAAGG + Intronic
972485736 4:39538528-39538550 TTAGATGAAGAGTTGATTAAGGG + Intergenic
978848455 4:113304235-113304257 TTTGGTGACCACTTTATTGATGG + Intronic
979061948 4:116073858-116073880 TTAGGAGACCAGTGTATTTATGG - Intergenic
982331923 4:154190576-154190598 TTATGTGAACACTTGATTAAAGG - Intergenic
984750268 4:183265650-183265672 GTAGATGAACAGTTAATTAATGG - Intronic
986063459 5:4213205-4213227 TTAGGTGATTAAGTCATTAAAGG + Intergenic
986079884 5:4379315-4379337 TTGGGTGACCAGTCCCTTGAGGG + Intergenic
987382540 5:17299191-17299213 TTAGATGACCAGCTCAGAAAGGG - Intergenic
988895640 5:35670806-35670828 TTAGGTGACCAGTTCATTAAGGG + Intronic
989002841 5:36778733-36778755 TTAGGAGACAAGGTCATAAAAGG - Intergenic
989389646 5:40886706-40886728 GTAGATGACCAGTTCAGTCATGG + Intergenic
996944171 5:129046766-129046788 TTAGGTGCCAAGTTAATAAAAGG - Intergenic
1004758178 6:18636381-18636403 TTAGATAACCAGCTAATTAAGGG + Intergenic
1006102862 6:31696766-31696788 TCAGGTGGACAGTTCACTAATGG + Intronic
1006795052 6:36726707-36726729 ATAGGGGACCAGTTAAATAAAGG + Intronic
1008465364 6:51824249-51824271 CTAGGTAATCAGTTCATCAAGGG + Intronic
1009263569 6:61526478-61526500 TTAGGTGACAAGTTCTGTAGTGG - Intergenic
1010761527 6:79728772-79728794 TCAGGAGACCAGTTCATTCTAGG + Intergenic
1013249975 6:108324465-108324487 TTAAGTGACCAGTTAGTTACTGG + Intronic
1014882324 6:126738518-126738540 TTCGGTGACCAATTTTTTAAAGG + Intergenic
1017227982 6:152042341-152042363 TTTGGAGATCAGTTAATTAATGG - Intronic
1021347088 7:19542052-19542074 TTAGCTGAACAGTAAATTAAAGG - Intergenic
1027715042 7:81659240-81659262 TTAGCTGACCACTTCCTTAAGGG + Intergenic
1029840934 7:103362326-103362348 TGAGGTTACCAGTCCATTTAAGG + Intronic
1031107777 7:117566757-117566779 TTTAATGACCAGTTCATGAAAGG - Intronic
1031370624 7:120960618-120960640 TGAGGTGACCAGTGCAGTGATGG - Intronic
1034824726 7:154251362-154251384 TTAGGTGGTCAGTTCCTTAATGG - Intronic
1036017290 8:4799250-4799272 GTAGCTCACCAGTTCATAAAAGG + Intronic
1040440454 8:47436352-47436374 TTAGATGACTAGTACATAAAAGG - Intronic
1041953856 8:63536007-63536029 TTAGAAGACCAATACATTAAGGG + Intergenic
1043883783 8:85574982-85575004 TTAAGGGACTAGATCATTAAGGG + Intergenic
1045835070 8:106510467-106510489 TTAGATGTCCTTTTCATTAAAGG + Intronic
1046849411 8:118955402-118955424 TGAGGTCACCAGTTGTTTAAGGG + Intergenic
1048065096 8:130959662-130959684 TTAGATGAACAGTTAATTGAAGG + Intronic
1049124646 8:140775723-140775745 TTATTTGCCCAGTTCATTAAAGG + Intronic
1053423648 9:37997126-37997148 TTCGATGACTAGTTCATAAAGGG - Intronic
1055225250 9:73987416-73987438 TTAGGTGAAAAGTTCTGTAAAGG - Intergenic
1060676096 9:125516317-125516339 TTAGCTGACACCTTCATTAATGG - Intronic
1188965351 X:36544919-36544941 TTAAGAGACGAGTTCATAAAAGG - Intergenic
1191676454 X:63796677-63796699 GTAGGAGACAAGTTCATAAATGG - Intergenic
1191870242 X:65739512-65739534 TTAGGGGACCAGTTGATAATGGG - Intronic
1192561245 X:72129520-72129542 GAGGGTGACCAGTTCATTTATGG + Exonic
1197830273 X:130634607-130634629 TTAATTGAGCATTTCATTAAAGG - Intronic