ID: 988906703

View in Genome Browser
Species Human (GRCh38)
Location 5:35798055-35798077
Sequence GGGAAGAAGTGGTCTCATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988906703_988906708 -2 Left 988906703 5:35798055-35798077 CCCGAATGAGACCACTTCTTCCC 0: 1
1: 0
2: 1
3: 41
4: 257
Right 988906708 5:35798076-35798098 CCAGCCCTATTGCCATCACCTGG 0: 1
1: 0
2: 1
3: 40
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988906703 Original CRISPR GGGAAGAAGTGGTCTCATTC GGG (reversed) Intronic
900666452 1:3818478-3818500 GGCGAGAAGTGGTCAGATTCTGG - Intronic
900848289 1:5121250-5121272 GGTGAGAAGTGGTCAAATTCTGG - Intergenic
900903720 1:5535653-5535675 GGGAAGAGGTGGCCTTATGCAGG + Intergenic
901201798 1:7471453-7471475 GGGAAGAGGTGGCCTCTTCCAGG - Intronic
901475523 1:9486676-9486698 GGGGAGACGTGGCCTCATGCTGG - Intergenic
901677128 1:10892051-10892073 GGAAAGAAGTGGTTTCCTTCTGG - Intergenic
903272886 1:22202723-22202745 GGGAAGAACTGTTCTGAATCTGG + Intergenic
903382960 1:22909438-22909460 GGGCAGATGTGGTCTCATTTGGG - Intronic
904257876 1:29267915-29267937 GGGGAGAAGTGGTCAGATTCTGG + Intronic
905171905 1:36114661-36114683 GGGAAGAGGTGCTTTCATGCAGG - Intronic
905173323 1:36121963-36121985 GGGAAGAAGAGGTCACATGTGGG - Intronic
907816310 1:57921609-57921631 GGCAAGAAGTGATCTGATTCTGG - Intronic
908768331 1:67573606-67573628 AGGAAAAAGTGCTCTCAATCTGG + Intergenic
910604549 1:89068595-89068617 GGGAAGAAGGGGTTTTATTTTGG + Intergenic
910775845 1:90873680-90873702 GGTAAGAAGGGGTTGCATTCTGG + Intergenic
911342658 1:96657504-96657526 AGGAAGAAATGGTGTCATTAAGG + Intergenic
911479924 1:98425587-98425609 GTGAAGAACTTGTCTCATTTTGG - Intergenic
912169243 1:107078193-107078215 GGGAACAAGTGGTGTAAGTCTGG - Intergenic
912302193 1:108529712-108529734 GGTGAGAAGAGGTCACATTCTGG - Intergenic
912407462 1:109452622-109452644 GGGAAGAAAAGTTCTCAATCCGG + Intergenic
913697531 1:121341925-121341947 GGTGAGAAGTGGTCAAATTCTGG + Intronic
914140028 1:144938127-144938149 GGTGAGAAGTGGTCAAATTCTGG - Intronic
914910870 1:151785325-151785347 GAGAAAAAGTGGTCAGATTCTGG - Intronic
915770775 1:158420584-158420606 GGAAAGAAATGGTCTTCTTCTGG + Exonic
915774283 1:158465822-158465844 GGAAAGAAATGGTCTTCTTCTGG - Exonic
916864994 1:168846933-168846955 GGGAAGAAGTGGTATCAGTTGGG - Intergenic
918165478 1:181942442-181942464 TGGAAGAAGTGCTGTCACTCAGG - Intergenic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
919550412 1:198978513-198978535 GGGAAGGAGTGATTACATTCTGG + Intergenic
920484920 1:206360574-206360596 GGTGAGAAGTGGTCAAATTCTGG + Intronic
920791783 1:209099710-209099732 GTGAAGAATTGGTGCCATTCAGG + Intergenic
921527811 1:216239792-216239814 GGCAAGAAGTGGTCAAATTCTGG + Intronic
922185118 1:223267339-223267361 GGGAAGAAGTGGCTGCAGTCCGG + Intronic
922326443 1:224532542-224532564 GGGCAGAAGTGGTTGTATTCTGG + Intronic
1063333767 10:5188793-5188815 GAGGAGAAGTGGTCAGATTCTGG + Intergenic
1064486245 10:15793928-15793950 TGGAAGATGTGGTCTCATAGAGG + Intronic
1065804621 10:29383115-29383137 GGTGAGAAGTGGTCTGACTCTGG + Intergenic
1065944512 10:30594618-30594640 TGGGAGAAGTGGTCTGACTCTGG - Intergenic
1067744520 10:48925580-48925602 GGGAAGCAGTGCTCACATTGGGG - Intronic
1067922129 10:50469964-50469986 GGGGGGCAGTGGTTTCATTCTGG + Intronic
1069245850 10:66204638-66204660 GGGAGGAAGTGGTCACCTTTGGG - Intronic
1069480467 10:68777155-68777177 CGTAAGAAGTGGACTGATTCTGG - Intronic
1071013901 10:80971746-80971768 GGGCAGAATTGCTCTCCTTCTGG + Intergenic
1071349454 10:84724995-84725017 GAGCAGATGTGGTCTCCTTCAGG + Intergenic
1078366456 11:10710641-10710663 GGTAAGAAATGGTCAGATTCTGG - Intergenic
1079034692 11:17012012-17012034 AGGGAGTAGTGGTCACATTCAGG - Intronic
1079067966 11:17314182-17314204 GGGGGGAAGTGGTCAAATTCTGG - Intronic
1079287707 11:19153934-19153956 GGTAAGAAGGGGTCAGATTCTGG - Intronic
1079455850 11:20635671-20635693 AGGAAGAAATGATGTCATTCTGG + Intronic
1080219644 11:29886489-29886511 GGTAAGAAGTGTTTTGATTCTGG - Intergenic
1080551814 11:33378927-33378949 GGGAAGAAGTGGTGTCAAGAGGG + Intergenic
1080926316 11:36760202-36760224 GGTGAGAAGTTGTCTTATTCTGG + Intergenic
1082726868 11:56746824-56746846 GGGGAGAAGTGGTCAGATTCAGG - Intergenic
1083147438 11:60769816-60769838 GGGAAGAAGCGGACACACTCAGG - Intronic
1083790387 11:64980978-64981000 GAAAAGAAGTGGTCGGATTCAGG - Intergenic
1085534182 11:77208238-77208260 GGCAAGAAGTGGGCTCTTCCGGG + Intronic
1088474327 11:110219557-110219579 AGGATGAGGTGGTCACATTCTGG + Intronic
1091002560 11:131922597-131922619 GGTAAAAAGTGGTCTGATTCAGG - Intronic
1091837767 12:3597739-3597761 GGGCAGAAGTGGCCTGCTTCAGG + Intergenic
1094068707 12:26389036-26389058 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1094626906 12:32132925-32132947 GGTAAGAAGTGATCTGATTCAGG + Intronic
1095199397 12:39364827-39364849 GGGAAGAAGAGGTTTGTTTCAGG - Intronic
1095377834 12:41552069-41552091 GGAAAGAAATGGTTTCATCCAGG - Intronic
1097700440 12:62814577-62814599 GGGAAAAAGTGGTATCCTCCTGG + Intronic
1097903445 12:64896375-64896397 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1098182362 12:67861417-67861439 GTGAAAAAGTAGTTTCATTCAGG - Intergenic
1098482921 12:70986744-70986766 GAGAAGGAATGGTCTCATTCTGG + Intergenic
1098605186 12:72381347-72381369 GGTCAGAAGTGGTAGCATTCTGG + Intronic
1099652675 12:85448211-85448233 GAGAAGAAGTGGTTAGATTCTGG + Intergenic
1100349073 12:93761422-93761444 TGGGAGAAGTGGTCACTTTCAGG + Intronic
1101982720 12:109421614-109421636 GGGAAGTAGAGATTTCATTCTGG + Intronic
1102510860 12:113414515-113414537 GGTGAGAAGTGGTCACATTCTGG - Intronic
1102855646 12:116290714-116290736 GGGAAGCAGTTGTCTGCTTCAGG - Intergenic
1103314562 12:120042128-120042150 GGGAAGAAGTGATAGCATCCTGG + Intronic
1103873693 12:124110607-124110629 AGGAAGAAGTTGTTTCATTTAGG + Intronic
1104134136 12:125921443-125921465 AGGAAGAAGACATCTCATTCTGG + Intergenic
1105600937 13:21886227-21886249 GGTGAGAAGTGATCCCATTCAGG + Intergenic
1106777305 13:33020702-33020724 GGGGAGAAGTGGTTTGATTCTGG - Intronic
1108071951 13:46637210-46637232 GACAAGAAGTGGTCACATTCAGG - Intronic
1109913523 13:68948870-68948892 GGAAAGAAGTGGTTTGAATCTGG - Intergenic
1110451905 13:75646257-75646279 GGCAAGAGGTGGTCAGATTCTGG - Intronic
1114347515 14:21811894-21811916 GGAAAGAAGTGGTTTCTTTACGG - Intergenic
1114358440 14:21941574-21941596 GGAAAGAAGTGGTTTCTTTACGG - Intergenic
1115185470 14:30683424-30683446 GTGAAAAGGTGGTCTGATTCAGG + Intronic
1116007353 14:39309102-39309124 GGTAAAAAGTGGTCAGATTCAGG - Intronic
1117060687 14:51959506-51959528 GGGACAAAGTAGTCTAATTCTGG - Intronic
1118204193 14:63706469-63706491 AGGTAGAAGTGGTCACATTCTGG - Intronic
1118250218 14:64152695-64152717 GAGAAGCAGTGTTCTCACTCAGG + Exonic
1118457441 14:65957793-65957815 CGGAAGGAGTGGAGTCATTCTGG - Exonic
1118575042 14:67233711-67233733 GGGGAGAAGTGGTTAGATTCTGG + Intergenic
1119935160 14:78585582-78585604 TGGCGGAAGAGGTCTCATTCTGG + Intronic
1120661131 14:87252471-87252493 GAAAGGAAGTGCTCTCATTCAGG - Intergenic
1124893379 15:33754158-33754180 GGTGAGAAGTGGTCAAATTCTGG - Intronic
1126988666 15:54344803-54344825 GGTGAAAAGTGGTCTGATTCTGG - Intronic
1128384738 15:67139418-67139440 GGGAAGAAATGATTTCATTGAGG - Intronic
1128404621 15:67323022-67323044 GGGAAGAAAGGTTCTCAATCTGG + Intronic
1128678450 15:69628824-69628846 GGGAGGAAATGGTCTCTATCTGG - Intergenic
1130155684 15:81348216-81348238 GGGAAGATTTGCTCTCATTCAGG - Intronic
1130979318 15:88802306-88802328 AGGAAGAAGTGGAATCTTTCGGG - Intergenic
1131114750 15:89787924-89787946 GGTAGGAAGTGGTATCATTATGG - Intronic
1131159925 15:90099044-90099066 GTGAAGAAGTGGTTGGATTCTGG - Intronic
1133804514 16:9114456-9114478 GGGAACAGGTGGGCTCACTCAGG + Intronic
1133853041 16:9524143-9524165 AGGAAAAAGTGGTCTCCTTGGGG - Intergenic
1136452755 16:30363237-30363259 GGGGAGAAGTGGTTGGATTCTGG - Intronic
1139294464 16:65888131-65888153 GAAAAGAAATGGTCACATTCAGG + Intergenic
1140058782 16:71549240-71549262 GGTGAGAAGTGGTCTGATTCAGG - Intronic
1140645795 16:77028669-77028691 GGGCAGAAATGGCCTCATTTTGG - Intergenic
1143094207 17:4468413-4468435 GTGGAGAAGTGGTCAGATTCTGG + Intronic
1144843145 17:18201091-18201113 AGGAAGTGGAGGTCTCATTCTGG + Intronic
1146210360 17:30937663-30937685 GGTTAGAAGTGGTCAGATTCTGG + Intronic
1148859899 17:50599392-50599414 GGGGAGGAGTGGTCTCAGGCAGG - Intronic
1150022115 17:61627892-61627914 GGTGTGAAGTGGTCTCATTGTGG + Intergenic
1151187186 17:72372940-72372962 TGGAAGAGGTGCTTTCATTCAGG - Intergenic
1151635845 17:75347301-75347323 GGGAAGATGGGTTCTCAGTCCGG - Intronic
1151903942 17:77035677-77035699 GGGAAGGGGTGGTCCCACTCTGG - Intergenic
1154065882 18:11106595-11106617 GTAAAGAAGAGGTCTCATTATGG + Intronic
1155041166 18:22066539-22066561 GGGAAGAGGTGGTCTGATATAGG + Intergenic
1156509111 18:37620678-37620700 GGGATGAAGTGGCATCAGTCAGG + Intergenic
1157400564 18:47383126-47383148 GGGAAGAGGTGGTCTGCTTTTGG + Intergenic
1158614255 18:58971392-58971414 GTGAAACAGTGGTCTCAATCAGG + Intronic
1158944392 18:62436214-62436236 GGGAAGAAGAGGGTTCTTTCTGG + Intergenic
1159312700 18:66730341-66730363 TGGAAGAAGTGTGCTCATACTGG - Intergenic
1159888581 18:73934130-73934152 GGGAAGACGGTGTCTCATTCGGG + Intergenic
1163001717 19:14372392-14372414 GGGAGGAAGGGGGCTTATTCAGG - Intergenic
1163064608 19:14783967-14783989 GGGAGGAAGGGGGCTTATTCAGG + Intergenic
1163549534 19:17957927-17957949 GGAAAAAAGTGGGCACATTCTGG + Intronic
1165098184 19:33421824-33421846 GCGGAGAAGTGGTCAGATTCTGG - Intronic
1165137008 19:33675864-33675886 GGGAAGCATTGTTCTCATCCAGG + Intronic
1167555622 19:50193356-50193378 GGCAAGAAGGGGTCGGATTCTGG + Intronic
1168283995 19:55321424-55321446 GGGAAGAAGGGCTGGCATTCGGG + Intronic
1168284291 19:55322701-55322723 GGGAAGAAGGGCTGGCATTCGGG + Exonic
1168602162 19:57726879-57726901 GGGTAGAAGTGATCATATTCTGG - Intronic
926943857 2:18167258-18167280 GGGAAGAGGTGTTCTCGTTTTGG + Intronic
928586237 2:32761294-32761316 GGTAAGAAGCAGTCTGATTCTGG - Intronic
929461943 2:42108810-42108832 GGCAAGAAGTGGTTGGATTCTGG - Intergenic
931057339 2:58487383-58487405 GGGAAGATGAGTTCTCAATCTGG + Intergenic
932863502 2:75318117-75318139 GATAAGAAGTGGTCTTATCCTGG + Intergenic
934875049 2:97910165-97910187 GGTATGAAGTGGTATCATTGTGG - Intronic
935222936 2:101030451-101030473 GGTAAGAAGTGGTATAATTATGG - Intronic
935829719 2:106988301-106988323 GGAAAGCAGGGGGCTCATTCTGG + Intergenic
936156138 2:110048510-110048532 GGGAAGCAGGGCTCTCATACAGG - Intergenic
936175410 2:110215655-110215677 GGTAAGAAGCGATTTCATTCTGG - Intergenic
936188549 2:110322918-110322940 GGGAAGCAGGGCTCTCATACAGG + Intergenic
937966258 2:127514014-127514036 GGGAATAAAGGTTCTCATTCCGG - Intronic
937967895 2:127527750-127527772 GGGGAGAAGTGGTTTCTCTCTGG + Intergenic
938248226 2:129795197-129795219 GAGCAGAAGTGGTCACATTCTGG + Intergenic
941422980 2:165306071-165306093 GGAAAGAATTGGTCTCAATGTGG + Intronic
941860906 2:170279335-170279357 GGTAAGAAGTGATCTCATTGTGG + Intronic
942326193 2:174778889-174778911 GGGAGGAAGTGGGCTCTCTCTGG - Intergenic
942489424 2:176474848-176474870 GGCAAGAAGTGGGCAGATTCTGG + Intergenic
942619132 2:177829028-177829050 GGTAAGAAGTGGTCAGATTCTGG + Intronic
942623090 2:177869330-177869352 GGGAAGAATGGAGCTCATTCAGG + Intronic
946037958 2:216759047-216759069 AGGAAGGAGTGGTCTATTTCGGG + Intergenic
946236555 2:218327816-218327838 AGGGAGAAGTGTTCACATTCTGG - Intronic
946261191 2:218492630-218492652 GGTAAAAAGAGGTCACATTCTGG + Intronic
946443609 2:219718619-219718641 GGGAAGCAGGGTTCTCATTAAGG + Intergenic
948250570 2:236525330-236525352 GGCAAGAGGTGGGCTCACTCTGG - Intergenic
948432728 2:237930327-237930349 GGGAAGACGGGTTCTCAATCTGG - Intergenic
948690075 2:239696458-239696480 GGGAAGAACATGTTTCATTCAGG + Intergenic
1168964059 20:1888255-1888277 GGGAAGGAGTGGTTGGATTCTGG + Intergenic
1169241441 20:3984470-3984492 GTGAGGCAGTGGTATCATTCAGG - Intronic
1170976884 20:21173242-21173264 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1171047877 20:21827858-21827880 GGCCAGAGGTGGTCCCATTCTGG + Intergenic
1172019486 20:31903196-31903218 GGTATGAAGTGGTATCATTGTGG + Intronic
1172620633 20:36316257-36316279 GGGCAGCAATGGCCTCATTCAGG - Intronic
1173130912 20:40392474-40392496 AGGATGATGTAGTCTCATTCTGG + Intergenic
1173849594 20:46209644-46209666 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1176876568 21:14135887-14135909 GGGAAGAAGGGGTCTTTTTTTGG - Intronic
1178227387 21:30738381-30738403 GGGAAACAGTCATCTCATTCTGG - Intergenic
1179207511 21:39296013-39296035 GGGAAGAAATTGTGTCATTAGGG - Intronic
1184001266 22:41675402-41675424 AAGAAGAAGTGGTCAGATTCAGG - Intronic
1184859401 22:47164652-47164674 GGAAGGAAATGGCCTCATTCAGG + Intronic
949576516 3:5343654-5343676 GTTAAGAAGTGGACTCACTCAGG - Intergenic
949590768 3:5491937-5491959 GGGCTGAAGTGGTCAGATTCTGG - Intergenic
950008759 3:9707460-9707482 GGGGAGAAGTGGTCAGATTCAGG + Intronic
952452128 3:33442033-33442055 GGGAAACATTGGTCTCATTGGGG + Intergenic
952909910 3:38174686-38174708 GGTGAGAAGTGGTCAGATTCTGG + Intronic
953997942 3:47535249-47535271 GGTGGGAAGTGGTCACATTCTGG - Intergenic
954160559 3:48718615-48718637 GGCAAGAAGTGATTTCATTCTGG - Intronic
954759012 3:52860713-52860735 GGGGAGAAGAGGTCAGATTCCGG + Intronic
955787011 3:62551367-62551389 TGGAAGAAGTGATCAAATTCTGG - Intronic
958193825 3:90217612-90217634 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
958417181 3:93888661-93888683 GGTAAGAAGTGGTCAGATTCTGG - Intronic
958558368 3:95708771-95708793 GGGAAGATGATGTCTCATTGTGG + Intergenic
959343474 3:105161540-105161562 GGGAAGAAGTGGTCAGGGTCTGG - Intergenic
960292710 3:115905781-115905803 CGGAAGAGGGGGTCTCATCCTGG + Intronic
960623533 3:119659156-119659178 GGGCAGAAATGGTCTTAGTCAGG - Intronic
962464864 3:135648888-135648910 AGGCAGAATTGGTCTCACTCAGG + Intergenic
963019432 3:140858607-140858629 CTGGAGCAGTGGTCTCATTCAGG + Intergenic
963410366 3:144920079-144920101 GGAAAGAAATGGACTGATTCTGG - Intergenic
963453226 3:145511634-145511656 GGAAAGAAGTGGTCAGATCCTGG - Intergenic
964691812 3:159458485-159458507 GGGAAGAAGTGGACTCAGCATGG + Intronic
964907868 3:161740512-161740534 GGGAAGAAGTTGTGTCATTAGGG + Intergenic
965660568 3:171037606-171037628 GGTAAGATGTGGTCAGATTCAGG - Intergenic
966013087 3:175105990-175106012 AGGAAGAGGTTGTCTCAGTCTGG + Intronic
966578715 3:181534816-181534838 AGGAAGAAATGGTATCATGCAGG - Intergenic
968208164 3:196823213-196823235 GGGAAAAAGTGGTGTGAGTCTGG + Intronic
968424993 4:517300-517322 GTGAAGAAGTGGTTGCATTCTGG + Intronic
969133442 4:5010550-5010572 GCTAAGAATTGGTCACATTCTGG + Intergenic
971489392 4:27195119-27195141 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
972065669 4:34939928-34939950 GGGAAGATGGGTTCTCAATCTGG + Intergenic
973547858 4:52000152-52000174 GAGAAGAAATGGTATGATTCTGG + Intronic
974133611 4:57787477-57787499 GGTAAGAAGTGGTCAGATTTGGG + Intergenic
974302040 4:60081470-60081492 GGAGCCAAGTGGTCTCATTCAGG + Intergenic
974356175 4:60815640-60815662 GGTAAGAAGTGGTTAGATTCTGG - Intergenic
977091181 4:92677736-92677758 GGGTAGAAGTGATCTAATCCTGG - Intronic
977529457 4:98183064-98183086 GAGGAGAAGTGGTCAGATTCTGG - Intergenic
979581985 4:122371516-122371538 GGTAAGAAGTGGATTCATTTGGG + Intergenic
981225542 4:142289924-142289946 GGTAAGACATGGTCACATTCTGG - Intronic
981831015 4:149001938-149001960 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
983937087 4:173509597-173509619 GGGAGGAAGTGAGCTCACTCGGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984395630 4:179194933-179194955 TTGAAGAAGTGATTTCATTCTGG - Intergenic
985188783 4:187348312-187348334 GGGAAGATGTGGTGCGATTCTGG - Intergenic
987236806 5:15950770-15950792 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
988398816 5:30734079-30734101 GGGAAGGAGAGTTCTAATTCTGG - Intergenic
988511373 5:31867450-31867472 CAGAAGAAGTGGTTTCCTTCAGG + Intronic
988906703 5:35798055-35798077 GGGAAGAAGTGGTCTCATTCGGG - Intronic
989533933 5:42541721-42541743 GGTAAGAAGTGATCGCATTCTGG + Intronic
992367354 5:76106249-76106271 GGCAAGAAGTGGTTACATTCTGG - Intronic
993030756 5:82703254-82703276 GGTGAGAAATGGTCACATTCTGG + Intergenic
993160782 5:84288259-84288281 GGTGAGAAATGGTCACATTCTGG - Intronic
997665344 5:135625870-135625892 GGGCAGGAGTGGACACATTCTGG + Intergenic
998952975 5:147410890-147410912 GGGAAGATCTGTTCTCAGTCAGG - Intronic
999524746 5:152392403-152392425 GGAAAGAAGAGATCACATTCTGG + Exonic
1000371049 5:160537055-160537077 GGCAAGAAGTGATCAGATTCAGG - Intergenic
1001097377 5:168786246-168786268 AGGAAGAAGCGGTCTCTTTGTGG + Intronic
1001456817 5:171868664-171868686 AGGGAGAACGGGTCTCATTCTGG + Exonic
1003087988 6:3076783-3076805 GGGAAAAAGTGGTACCATTTTGG + Exonic
1005020927 6:21418168-21418190 GGGAAGCAGTGGTGTAATTCCGG + Intergenic
1006834891 6:36992021-36992043 GGGTAGAAGTGGTCCCACACCGG - Intergenic
1007381275 6:41491751-41491773 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1007448173 6:41923019-41923041 GGTGAAAAGTGGTCTCATTTTGG - Intronic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1011587592 6:88943424-88943446 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1011598628 6:89039897-89039919 GGCAAGAAGTGGTGAAATTCAGG - Intergenic
1013041989 6:106444509-106444531 AGGAAGAAATGATTTCATTCTGG - Intergenic
1013091470 6:106904548-106904570 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1013581848 6:111542812-111542834 GGAAAGTAGTGGTCAGATTCTGG + Intergenic
1015805542 6:137104838-137104860 GGAAATAACTAGTCTCATTCTGG + Intergenic
1016162756 6:140901758-140901780 GGGAAGAAGTTTTCTCAATCAGG + Intergenic
1016430740 6:143982653-143982675 GGGGAGAAGTGGTCACCTTCTGG + Intronic
1017526848 6:155248390-155248412 GGGTAGAAATGATCTCATCCGGG + Intronic
1018285104 6:162229367-162229389 GGTGAGAGGTGGTCTCATTCTGG - Intronic
1020681716 7:11245266-11245288 GGTAAGAAGTGGTTGAATTCTGG + Intergenic
1021603336 7:22386587-22386609 GGTGTGAAGTGGTCTCATTGTGG + Intergenic
1021955550 7:25821001-25821023 GTTAAGAAGTGTTATCATTCTGG + Intergenic
1022639815 7:32171076-32171098 GGGAAGCACTGGTGTCAGTCAGG - Intronic
1022781538 7:33589507-33589529 GGTGAGAAATGGTCTTATTCTGG + Intronic
1023759717 7:43453284-43453306 GGTGAGGAGTGGTCTGATTCTGG + Intronic
1025023419 7:55497370-55497392 GGGAAGAAGAGCTCTGCTTCTGG - Intronic
1026501171 7:70944586-70944608 GAGGAGAAGTGGTCAGATTCAGG - Intergenic
1028637629 7:93007330-93007352 GGGAGGAAGTTGTCTGACTCTGG + Intergenic
1031624800 7:123980058-123980080 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1032387302 7:131533620-131533642 GGGAAGAAGTGGTGTGAACCAGG - Intronic
1032632782 7:133671699-133671721 GGGGAGAAGTGGTCACATTCTGG + Intronic
1032998200 7:137471748-137471770 AGGAAAAAATGGTCTCATTCAGG + Intronic
1037157295 8:15718997-15719019 GGTAAGAAGTGATCTTATCCTGG - Intronic
1037223360 8:16553363-16553385 GATGAGAAGTGGTCACATTCTGG + Intronic
1037363212 8:18095778-18095800 GGTGAGAAGTGGTCAGATTCGGG - Intergenic
1041872901 8:62655224-62655246 AGGCAGAGGTGGACTCATTCTGG - Intronic
1042145089 8:65719869-65719891 GCTAAGAAGGGGTCTCCTTCAGG + Intronic
1043701667 8:83295790-83295812 GGTAAGATGTGATCTCATTGTGG + Intergenic
1044211842 8:89559989-89560011 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1045159846 8:99526489-99526511 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1045686715 8:104720209-104720231 GGCAAGAAGTGGTTTGATTCTGG + Intronic
1045954169 8:107887681-107887703 GGAAAGAAGTGGTTGGATTCAGG - Intergenic
1048037212 8:130688649-130688671 GGTAAGCAGTGGTGTCAGTCAGG - Intergenic
1049980022 9:895397-895419 TGCAAGAACTGTTCTCATTCTGG + Intronic
1050253719 9:3772445-3772467 GGAAAGAAGTGGTTGAATTCTGG - Intergenic
1051783226 9:20713094-20713116 GGTACCAAGTGGTCACATTCTGG - Intronic
1052858920 9:33424685-33424707 GAGAAGAAGGGGTCTTCTTCAGG + Intergenic
1053536099 9:38927874-38927896 AGTCAGAAGTGGTCTGATTCAGG - Intergenic
1054630037 9:67436078-67436100 AGTCAGAAGTGGTCTGATTCAGG + Intergenic
1055652804 9:78423301-78423323 GGGAACAAGTAGACTCCTTCTGG + Intergenic
1055676612 9:78669050-78669072 GGTAAAAACTGGTCTCTTTCTGG + Intergenic
1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG + Intergenic
1057457739 9:95229417-95229439 GGTAGGAAGTGGTCAGATTCTGG + Intronic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1058672745 9:107374281-107374303 GGGAAGGAGTGGTTGGATTCTGG + Intergenic
1058909769 9:109510075-109510097 GGGAAGTGTTGGTCCCATTCAGG + Intergenic
1059225399 9:112668118-112668140 TGGAAGCAGTGGACTCTTTCAGG - Intronic
1061069880 9:128302796-128302818 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1061225539 9:129278950-129278972 GGGCAGACATTGTCTCATTCTGG + Intergenic
1062254319 9:135613964-135613986 AGGAGGACGTGGGCTCATTCGGG - Intergenic
1062645857 9:137547778-137547800 GGGAAGAAGTGATCTCGCCCGGG + Intronic
1186088658 X:6020277-6020299 GGAAAGAAGTTGTGTCATTTGGG + Intronic
1187498156 X:19814212-19814234 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG + Exonic
1187967593 X:24627781-24627803 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1191693918 X:63968588-63968610 GGTAAGAAGTGGGCACATTATGG + Intergenic
1192543614 X:71995168-71995190 GGTAACAAGTGGTTTGATTCTGG - Intergenic
1194461530 X:94175586-94175608 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1195084367 X:101400376-101400398 GGAAGGAAGTGGGCTGATTCAGG + Intronic
1195365618 X:104122553-104122575 GGGCTGAAGTAGTCTCATTACGG - Intronic
1195534857 X:105999621-105999643 GGTAAGAAGTGTTCGAATTCTGG + Intergenic
1196725791 X:118893898-118893920 AGGAACAAGTGGCCACATTCTGG + Intergenic
1198651875 X:138872099-138872121 GGGAAGAAGTAGTTAGATTCTGG + Intronic
1199222499 X:145333796-145333818 GGGAAGAATTGTTATCATTTTGG + Intergenic
1201406040 Y:13651625-13651647 GGGAAGAGGTGTTCTGGTTCTGG + Intergenic