ID: 988907561

View in Genome Browser
Species Human (GRCh38)
Location 5:35804805-35804827
Sequence AATTAAGCAAAGAAGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988907561_988907564 26 Left 988907561 5:35804805-35804827 CCAGGTTCCTTCTTTGCTTAATT 0: 1
1: 0
2: 0
3: 32
4: 419
Right 988907564 5:35804854-35804876 CTAATTGTTTGCTTGCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988907561 Original CRISPR AATTAAGCAAAGAAGGAACC TGG (reversed) Intronic
902079289 1:13810210-13810232 AATTAAGCATGCATGGAACCCGG + Intronic
902176506 1:14654711-14654733 CATTAACCAAAGAAGCAACCAGG - Intronic
903033965 1:20482473-20482495 AATTAAGAAAAGAGGGAACGGGG + Exonic
903466279 1:23554625-23554647 AACGAAGGAAGGAAGGAACCGGG + Intergenic
904498927 1:30902914-30902936 AATAAAGGAATGAAGGAAGCCGG - Intronic
904506610 1:30961212-30961234 AATAAAGAAAAAAAGGAGCCAGG + Intronic
904874738 1:33645508-33645530 AATCAAGCAAGGAAGGGAGCTGG + Intronic
905133710 1:35781075-35781097 AATACAGCAAAGAAGCATCCTGG - Intergenic
907957120 1:59240365-59240387 AATTGGGAAAGGAAGGAACCAGG + Intergenic
908103014 1:60810667-60810689 AATTCATGAAAGAAGGATCCAGG - Intergenic
908215747 1:61949902-61949924 AAAAAAGCAAAGAAGGGACCAGG + Intronic
909616172 1:77611182-77611204 AATTATCCAAAAAAGAAACCAGG + Intronic
909658011 1:78052234-78052256 AATTAAGCAGAGAAGGGAACAGG - Intronic
909762506 1:79309413-79309435 AATGAAACAAAAAAGGAACTAGG + Intergenic
910483876 1:87688677-87688699 ATTTAAGCAAAGATTGAACCTGG - Intergenic
910633772 1:89384417-89384439 AATTAAGAAAAAAAGGATTCAGG - Intronic
910757681 1:90709364-90709386 AAGGAAGGAAGGAAGGAACCAGG + Intergenic
910841787 1:91568303-91568325 AATAACGCCAAGAAGCAACCTGG - Intergenic
910936870 1:92491065-92491087 AATTAAGTAAAGGAGAAACATGG + Intergenic
911031090 1:93489092-93489114 AAAAAAGAAAAGAAAGAACCAGG - Intronic
911730821 1:101290804-101290826 AAGGAAGCAGAGAAGGAATCTGG - Intergenic
911750406 1:101490184-101490206 AATGAATAAAAGAAAGAACCCGG - Intergenic
912661493 1:111535252-111535274 AAGTTAGCACAAAAGGAACCTGG - Intronic
912747294 1:112255627-112255649 ATTTGAGCAAAGAAAGATCCTGG + Intergenic
915782793 1:158571393-158571415 CAAGAAGCAAAGAAGTAACCTGG - Intergenic
916417999 1:164610498-164610520 AATTAAGCCAGGAAGGCACTGGG + Intronic
917491031 1:175498660-175498682 AGTTAAGCAGAGAAGGAATATGG + Intronic
918446541 1:184622758-184622780 AACTTAGCAAAGACGGACCCAGG + Exonic
920361726 1:205422464-205422486 AATTAAGAAAATAAGAAATCAGG + Intronic
920634733 1:207689712-207689734 AATTCAGCAATGAAGCAATCTGG + Intronic
920750594 1:208670999-208671021 AATGAAGCAAAGAAAGAAAGAGG - Intergenic
920756051 1:208734136-208734158 TATTAAGCATAGAATGAACAAGG + Intergenic
921338196 1:214108740-214108762 AATAAAGCAGAGAAGGGACCTGG - Intergenic
922221253 1:223610284-223610306 TGCTAAGCAAAGAAGGAAGCAGG + Intronic
922341493 1:224659588-224659610 TATAAAGGAAAGAAGAAACCGGG + Intronic
922484075 1:225959678-225959700 AATAAATAAAAGAAGGGACCCGG + Intergenic
923582540 1:235231957-235231979 AAGTAAGCAAAGAATTAGCCAGG + Intronic
924203528 1:241686337-241686359 AATTAAAGAAAGAAGTAGCCAGG + Intronic
924805348 1:247357318-247357340 ACTTAAGCATAGAAGGAGGCGGG - Intergenic
1063855703 10:10251141-10251163 AATTAATCAATGAAGCCACCTGG - Intergenic
1064272584 10:13878837-13878859 AAGGAAGGAAGGAAGGAACCTGG + Intronic
1064385667 10:14888802-14888824 AATGAATTAAAGAATGAACCAGG + Intronic
1064895303 10:20228651-20228673 AAGGAAGGAAAGAAGGAAGCAGG + Intronic
1066169127 10:32822242-32822264 AATTAAGAAAAGAAAGAAGGTGG - Intronic
1067196424 10:44123396-44123418 AGATAAGGAAAGAAGGAACTAGG + Intergenic
1067202479 10:44185346-44185368 AATTGAGAAAAGAAGGAAGAAGG + Intergenic
1067235511 10:44444644-44444666 AAAGAAGGAAAGAAAGAACCAGG + Intergenic
1067316606 10:45172101-45172123 AATAAGGCATAGAAGAAACCAGG + Intergenic
1068138902 10:52979351-52979373 AATTAAAGAAAGAAGGAAGGAGG - Intergenic
1068717155 10:60200947-60200969 AATCAAGTAAAGAAGTAATCTGG - Intronic
1070338911 10:75478978-75479000 AATGAAGCCAAGAAAGAAGCTGG - Intronic
1070476440 10:76833912-76833934 AATTGAGCAAAAAGGAAACCTGG - Intergenic
1071131524 10:82398914-82398936 ACTTAAGTACAGAAGGAAGCAGG + Intronic
1072600377 10:96921440-96921462 AATTAAATAAAGAATGAAGCTGG - Intronic
1073099356 10:100998879-100998901 GATTATGGAAAGAAGGAACGCGG + Intronic
1073493787 10:103873215-103873237 AATAAAGAAAAAAAGGGACCAGG - Intergenic
1073585842 10:104709122-104709144 AAAAAAGGAAAGAAGTAACCTGG - Intronic
1075269636 10:121037452-121037474 AATTAGGCAAAGTAAGAAACTGG + Intergenic
1078412424 11:11137053-11137075 AATAAAGAAAAGAAAGAATCTGG + Intergenic
1079685466 11:23353793-23353815 TATTAAGCAATAAAGGAATCAGG - Intergenic
1079769444 11:24440823-24440845 AATGAATCAAAGATGTAACCAGG - Intergenic
1079910242 11:26300814-26300836 AATAAAGTAAAGAAGTACCCAGG - Intergenic
1079923523 11:26461772-26461794 TAATAAGCAAAAAAGGAACATGG - Intronic
1080032002 11:27671304-27671326 AATTAAAAAAAAAAAGAACCTGG + Intronic
1080170950 11:29302036-29302058 AATGAAGGAAAGAAGGAAGGGGG + Intergenic
1081660589 11:44885699-44885721 AATGAATCAAAGAGAGAACCTGG - Intronic
1081752483 11:45521779-45521801 GATGAAGCAAAGAAGGGATCAGG + Intergenic
1082209157 11:49476525-49476547 TATTAAGCAAAGAAGTTACAGGG + Intergenic
1082631404 11:55546286-55546308 AATTAAGCAAAGCAGGATATGGG + Intergenic
1083353709 11:62049317-62049339 AATGAAGCAAGGAAGGAAGGAGG + Intergenic
1084352012 11:68608892-68608914 AACTTTACAAAGAAGGAACCAGG + Intronic
1084964509 11:72737543-72737565 ATTTAGGGAAAGAAGGAAGCTGG - Intronic
1086843328 11:91716953-91716975 AAGAAACCAAAGAAGGTACCTGG - Intergenic
1087061676 11:93984939-93984961 AATAAAGAAGAGAAGGAAGCAGG + Intergenic
1087816329 11:102663035-102663057 AAGTAAGCAAGGAAGGAGACTGG - Intergenic
1088529251 11:110790697-110790719 AATTAAGCATAGATGGAAGCGGG - Intergenic
1088834832 11:113568754-113568776 GATTAAGCAGAGAAGGAACACGG + Intergenic
1088875836 11:113935641-113935663 AATTTAGCAACCAAGGCACCTGG + Intronic
1089621691 11:119726366-119726388 AAGCAAGCAGAGAAGGCACCAGG + Intronic
1090319152 11:125826935-125826957 AATGAAGCAAAGAAAAAACCAGG - Intergenic
1090676746 11:129006219-129006241 AATGAAGTAAATAAGGCACCAGG - Intronic
1092436844 12:8454848-8454870 AATTAAAAAAAGAATGAATCAGG + Intergenic
1092509895 12:9143954-9143976 AATTAAGCTGAGAAGAAACTGGG + Intergenic
1092559448 12:9595528-9595550 TATTAAACAAAGAAGGCACACGG + Intronic
1094205960 12:27840877-27840899 AATTCAGCAAAGAAGAAAAGTGG + Intergenic
1094438811 12:30452293-30452315 AATAAAGCAAGGATGGAACTAGG - Intergenic
1094823046 12:34242124-34242146 AATGAACCAAAAAAGGAACCAGG - Intergenic
1095091630 12:38112955-38112977 AATGAACTAAAAAAGGAACCAGG + Intergenic
1096173784 12:49497289-49497311 AATAAAGCAAATAAAGAAACAGG - Intronic
1096223636 12:49849315-49849337 ATTAAAACATAGAAGGAACCTGG + Intergenic
1097059858 12:56274693-56274715 AATTAAGAAAAGAATGAAAGAGG - Intronic
1097708390 12:62892462-62892484 ATTTTTGCAAAGAAGCAACCAGG - Intronic
1099134099 12:78872607-78872629 AATGAAGAAAAGAAGGAAGAAGG - Intronic
1099608978 12:84841260-84841282 AAATAAGCAAACAAGGAATAAGG - Intergenic
1099706773 12:86164043-86164065 AAATAAGCAAAGAGGGAAGAAGG + Intronic
1099886583 12:88538496-88538518 GTTTCAGCAGAGAAGGAACCTGG + Intronic
1100361034 12:93879660-93879682 AATTAAGGAAAGACACAACCTGG - Intronic
1100403977 12:94257083-94257105 AATTAAGAAAAGATAGAACAGGG + Intronic
1100921118 12:99488337-99488359 AGTGAAGCAAAGAAGAAACATGG - Intronic
1101140452 12:101790404-101790426 AATTTAGCAAAGAAGGGAGCTGG + Intronic
1101917213 12:108904879-108904901 AATTAAGAATAGAAGGATCATGG + Intergenic
1102849017 12:116220792-116220814 AATTAACCAAATAAGTTACCAGG + Intronic
1103068847 12:117923781-117923803 AACTAAGTAAAGAAGAAAACAGG + Intronic
1103172260 12:118831712-118831734 CCTTAAACAAAGAAGGAATCAGG - Intergenic
1103481925 12:121255958-121255980 AATTTAGCAAAGCAGGACCTTGG - Intronic
1103638303 12:122327521-122327543 AAGTAAGCAAGCAAGGAATCAGG - Intronic
1104353446 12:128064965-128064987 GATTAAGCAAAGAAGAAAGAAGG + Intergenic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1106702206 13:32241963-32241985 AAGTGAGCAAAGAAGGTTCCAGG - Intronic
1106875868 13:34072219-34072241 TATTAAGCAGAGAAGTGACCTGG - Intergenic
1108153253 13:47558374-47558396 AAATAAGCAAGGAAAGAAGCAGG - Intergenic
1108312602 13:49210750-49210772 AATGAAACAAAGAATGAATCAGG - Intergenic
1108543652 13:51468738-51468760 AAGTAAAGAAAGAAGGAACAAGG - Intergenic
1110203403 13:72881420-72881442 AATTAAACAAAGAAGTGGCCGGG + Intronic
1110448406 13:75614417-75614439 AATTCAGCAATGAAGCCACCAGG + Intergenic
1110690229 13:78424035-78424057 AATTCAGCAAAGAAGTTAACAGG + Intergenic
1110751782 13:79123224-79123246 ATTGAAGCAAAGCTGGAACCTGG - Intergenic
1110837475 13:80101146-80101168 AATGAGGCATAGAAGTAACCTGG - Intergenic
1111105880 13:83644094-83644116 AATTCAGCAGAGAAGCCACCAGG + Intergenic
1111731241 13:92079575-92079597 AAGTAAGGAAAGAAGGAGCCTGG - Intronic
1111980284 13:95008323-95008345 AATCAAGCATACAAGCAACCAGG - Intergenic
1112242812 13:97698826-97698848 AAATAAGCAAAAGAGGAGCCTGG + Intergenic
1112698527 13:101977556-101977578 AAGAAAGCAAAGAAGGAAGAAGG - Intronic
1113002208 13:105654171-105654193 AATGAAGGAGAGAAGGAACATGG - Intergenic
1113211039 13:107981653-107981675 AAGGAAAGAAAGAAGGAACCTGG - Intergenic
1114783595 14:25569279-25569301 AATGAACCAAATAAGGCACCAGG - Intergenic
1116154852 14:41190022-41190044 AATAAACTAAAGAAGGCACCAGG + Intergenic
1116649266 14:47568029-47568051 AATGAAGAAAAGAAGGAAAATGG - Intronic
1116819168 14:49611043-49611065 AATTTTGCATAAAAGGAACCTGG + Intronic
1117036508 14:51735253-51735275 AATAAAGCAAAGAGGCAGCCAGG + Intergenic
1117384079 14:55193882-55193904 AATGAACTAAATAAGGAACCAGG - Intergenic
1117442478 14:55773107-55773129 AATTGAGAAAAGGAGGAACTGGG - Intergenic
1118663541 14:68041500-68041522 AATTAAGGAAGGAAGGAAAGTGG - Intronic
1118915002 14:70095413-70095435 ACTGAGGCACAGAAGGAACCTGG - Intronic
1119676876 14:76562453-76562475 AAACAAACAAAGAAGGAACTTGG + Intergenic
1120462938 14:84820311-84820333 AATTGAGCAAAGCAGGATTCTGG - Intergenic
1120666419 14:87311383-87311405 AAGGAAGCAAAGAAGGAAGGAGG - Intergenic
1121914793 14:97828409-97828431 AATTCAGCAAAGAGAGAATCTGG + Intergenic
1123854191 15:24390448-24390470 CATTCACCAAAAAAGGAACCAGG - Intergenic
1124418491 15:29494073-29494095 AATTAAGAAAATAAGTAACAAGG + Intronic
1124722098 15:32119302-32119324 CATTAATGAAGGAAGGAACCAGG - Intronic
1125919986 15:43519651-43519673 AATTCAGCAAAGAAAGAAAGTGG - Intronic
1126517483 15:49552965-49552987 AATTAACTAAATAAGGCACCAGG - Intronic
1126546564 15:49880542-49880564 CTTTAAGCAAAGGAGCAACCTGG + Intronic
1128636024 15:69302930-69302952 AATGAAGCAAAGAAGAAGCAGGG - Intronic
1129310860 15:74707982-74708004 AATTAAGAAAAAAAAGAACAAGG + Intergenic
1129819884 15:78592328-78592350 AAATAAGCAGAGAAGTAACAGGG + Intronic
1130035754 15:80359977-80359999 CAATAAACAAAGAAGGAAGCAGG + Intronic
1132357210 15:101180652-101180674 ACTGAAGCAAAGAAGTAACCTGG + Intronic
1132490562 16:227925-227947 AAAAAAGCAAAAAAGGAACTAGG + Intronic
1134068341 16:11244728-11244750 AATGGAGGAAAGGAGGAACCAGG - Intergenic
1134173516 16:11987824-11987846 AATTAAGCTAAAAAGGAACAGGG - Intronic
1135034847 16:19068317-19068339 AAACAAGGAAAGCAGGAACCAGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135285113 16:21186733-21186755 AAATAAACAAACAAGAAACCTGG - Intergenic
1136389016 16:29950514-29950536 AATGAACCAAAGAAGCCACCAGG - Intronic
1137764870 16:50970273-50970295 AATAAAGCAAGGAGGGACCCAGG + Intergenic
1137936647 16:52641138-52641160 TATTAAGCAAAGTAGTAAGCTGG - Intergenic
1138258364 16:55591687-55591709 AAATAAGCTTAGAAAGAACCAGG - Intergenic
1138739863 16:59295534-59295556 AAGAAAGGAAAGAAGGAAGCAGG + Intergenic
1139058998 16:63225396-63225418 AATTTATCAAAAAAGGTACCAGG + Intergenic
1139811846 16:69625871-69625893 AATAAAGCCAAGAAGAAAACAGG + Intronic
1140889324 16:79271758-79271780 GACTAAGCAAGGAAGAAACCTGG - Intergenic
1140959370 16:79897432-79897454 AATTATGCAAATAAAGAAGCTGG - Intergenic
1141301629 16:82821495-82821517 AATTATGGAAAGAAGGAATGTGG - Intronic
1141484404 16:84329294-84329316 AAGCAAGCAAAGAAGGATCAGGG - Intronic
1141610273 16:85177221-85177243 ATCTAAGCAGAGGAGGAACCAGG - Intronic
1143413845 17:6730287-6730309 AATGAACTAAATAAGGAACCAGG - Intergenic
1144175714 17:12705141-12705163 ACTTCAACAAAGAAGGACCCAGG + Exonic
1146628839 17:34455603-34455625 TTTTAAGCAAAGAAGGGACATGG + Intergenic
1146805790 17:35864203-35864225 AGTTCAGGAAAGAAGGAAACAGG - Intronic
1150496632 17:65612886-65612908 AATTAAGGAAAGCAGGAGGCCGG + Intronic
1151108186 17:71643190-71643212 AATTAAGGGAAGAAGGGACAAGG + Intergenic
1151505934 17:74527064-74527086 AATTCTGCAACGAAGGAATCTGG - Intronic
1152057497 17:78041421-78041443 TATTAAATAAAGAAGGAAACTGG - Intronic
1154408509 18:14119453-14119475 AATTAGGCAAGGAAAGAACAAGG + Intronic
1155078983 18:22388934-22388956 AAACAAGCAAAGCAGGAAACTGG - Intergenic
1156203930 18:34865354-34865376 AATAAAACAAAGAAGGAAAGAGG - Intronic
1156293274 18:35768693-35768715 ATTTCAGCAAAAAAGGCACCTGG + Intergenic
1156785040 18:40901361-40901383 AAATAAGCAAAGAAATATCCAGG - Intergenic
1157499529 18:48179950-48179972 AAGGAAGCAAGGAAGGAAGCAGG - Intronic
1158521665 18:58176292-58176314 AATGAAGCAAGGAAGGAAGGAGG - Intronic
1159063526 18:63542406-63542428 AATCTAGCAGAGGAGGAACCAGG - Intergenic
1160548353 18:79677303-79677325 AATTGAGCAAAGAATGATTCAGG + Intergenic
1162865371 19:13541887-13541909 AAGGAAGGAAAGAAGGAACGGGG + Intronic
1164392328 19:27835760-27835782 AATGAACTAAAAAAGGAACCAGG + Intergenic
1165526563 19:36360473-36360495 GATGAAGAAAGGAAGGAACCTGG - Exonic
925107194 2:1301858-1301880 AAATGATGAAAGAAGGAACCTGG + Intronic
925890307 2:8428251-8428273 AAGTAAGGAAAGAAGGAAGGAGG + Intergenic
926354341 2:12026500-12026522 AATAAATCAAATAAGGAATCCGG - Intergenic
926478491 2:13357903-13357925 AATTAAGTAAATAAGACACCAGG + Intergenic
928054761 2:28041723-28041745 AATTGAGCAAAGATGGAAAGAGG - Intronic
928878302 2:36067031-36067053 TATGAAGCAAATAAGAAACCTGG + Intergenic
929700203 2:44156144-44156166 ATTTAAGCAAAGAAAGAATGTGG + Intergenic
929846248 2:45531650-45531672 TATGAAACAAAGAAGTAACCAGG + Intronic
930156038 2:48108489-48108511 AATTAAGAAAAGAAGGAAATGGG + Intergenic
930193483 2:48484251-48484273 AAGAAATCAAAGAAGGAAGCAGG - Intronic
930236228 2:48891249-48891271 AAGGAAGAAAAGAAGGAAGCAGG - Intergenic
930266269 2:49203061-49203083 AATTAATCAAAGAAAGAGTCTGG - Intergenic
931451105 2:62368488-62368510 AAGCAAGCAGAGAAGGATCCAGG + Intergenic
932325542 2:70857924-70857946 AATTCAGCAATGAAGCAATCAGG + Intergenic
934912339 2:98270857-98270879 AATTATGCAAACAAGGCCCCGGG + Exonic
935173711 2:100629747-100629769 AAGGAAGCAAAGAAGGAAGAAGG - Intergenic
935307981 2:101756333-101756355 AATTAAGCCAAGAGGGAATCTGG + Intronic
936456196 2:112676069-112676091 AATTAAACAAAAAAGGATCTGGG + Intergenic
937298471 2:120824025-120824047 TATTTAACAAAGAAAGAACCAGG + Intronic
937516208 2:122658310-122658332 AATTAATTAAAGAAAGATCCAGG - Intergenic
937560707 2:123220131-123220153 AATGAACTAAATAAGGAACCAGG + Intergenic
937863987 2:126734214-126734236 ACTTAAGCACAGAAGCAACAGGG - Intergenic
938319400 2:130353146-130353168 AACTAAGCAAAAAAGGAAGCTGG + Intergenic
939062565 2:137440736-137440758 AAATAAGCAAATAAGTAAGCAGG + Intronic
939711383 2:145524550-145524572 TATTAAGTTCAGAAGGAACCTGG - Intergenic
940239908 2:151551374-151551396 AATTCAGAAGAGAAAGAACCTGG - Intronic
940611890 2:156003722-156003744 AATTAGGCAAACAAGGAAAAAGG - Intergenic
942316671 2:174702724-174702746 AAATAAACAAAAAAGGAGCCTGG - Intergenic
942831399 2:180240539-180240561 AATGAAGGAAAGAAGGAATAAGG - Intergenic
943143588 2:184014628-184014650 AAATAAGCAAATAAGGAAGGAGG - Intergenic
943557505 2:189423752-189423774 AATTCAGCAATGAAGCCACCAGG - Intergenic
943858034 2:192823920-192823942 AAGGAAGGAAAGAAGGAACAAGG + Intergenic
944104543 2:196065577-196065599 AATTATCCAAAAAAGGCACCAGG + Intronic
944604178 2:201334897-201334919 AATTAAGCAGTAAAGGCACCAGG + Intronic
945331554 2:208545688-208545710 ACTTAAGCAAAGACAGAAGCTGG + Intronic
947441840 2:230129770-230129792 AACTAAGCACAGAACTAACCAGG - Intergenic
948524485 2:238562374-238562396 AATTAAGCAAATAAGAAGTCAGG - Intergenic
1169151064 20:3289805-3289827 AATAAAGCAGAGAAGGGGCCAGG - Intronic
1169716898 20:8629774-8629796 AAGAAAGGAAGGAAGGAACCAGG - Intronic
1170432829 20:16292900-16292922 AAACAAGCAAAGAAAGAATCAGG + Intronic
1170985730 20:21256510-21256532 AATGAAGGAAAGAAGGAACGAGG + Intergenic
1172544176 20:35746548-35746570 AATCAAGTGCAGAAGGAACCTGG - Intergenic
1173703389 20:45092778-45092800 AATTAAGCAAATGAGGTTCCAGG - Exonic
1174125927 20:48306196-48306218 TATTAAGTAAAGAAGCAAACAGG + Intergenic
1174863993 20:54117977-54117999 AAGAAAGCAAAGAAGGAATAGGG + Intergenic
1176207414 20:63896669-63896691 AATTAAGCGAGGAAGGGAACTGG - Intronic
1178043943 21:28673108-28673130 AAGGAAGCAAAGAAGGAAGGAGG + Intergenic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1179274461 21:39879372-39879394 AAGACGGCAAAGAAGGAACCTGG - Intronic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1181717090 22:24738868-24738890 AATGAACCAAATAAGGCACCAGG + Intronic
1181758519 22:25041730-25041752 AAATAAACAAACAAAGAACCAGG - Intronic
1181894139 22:26092240-26092262 TATTCAGCAGAGAAGGAAACTGG + Intergenic
1182399423 22:30063394-30063416 AATCAAGGTAAGAAGGAACTAGG + Intergenic
1182399467 22:30063996-30064018 AATCAAGGTAAGAAGGAACTAGG - Intergenic
1184358264 22:43996868-43996890 ACTGAAGCAAAGACGGAGCCTGG + Intronic
1185001888 22:48251246-48251268 AAGGAAGGAAAGAAGGAAGCAGG - Intergenic
949090715 3:25637-25659 AATTGAGCAAAGAGTGAATCAGG - Intergenic
949148236 3:730557-730579 AAATAAGGAAAGAAGGAATAAGG - Intergenic
949673836 3:6429710-6429732 AAGAAAGGAAAGAAGGGACCAGG - Intergenic
950019856 3:9779647-9779669 AATTAAAAAAAAAAGAAACCTGG + Intronic
950494680 3:13326658-13326680 ACTTAAGCAAAGAAGGACACTGG - Intronic
950885762 3:16361538-16361560 AACTAAGCAAGCAAGGAACATGG + Intronic
951880494 3:27476942-27476964 AATTTAGCAATGAATGACCCAGG + Intronic
951929642 3:27951226-27951248 AATGAAGTAAATAAGGCACCAGG - Intergenic
952466707 3:33596626-33596648 AATTAAGAGAAGAATGAACAAGG + Intronic
952592841 3:34978292-34978314 AATTCAGCAATGAAGCCACCAGG + Intergenic
953446046 3:42968370-42968392 AATTAACCAGAGAAGCCACCTGG + Intronic
954111701 3:48437184-48437206 AATAAAGCAGAGAAGGTAGCTGG - Intronic
954462981 3:50638246-50638268 GAGGAGGCAAAGAAGGAACCCGG + Intronic
954562008 3:51564789-51564811 AATTAAAAAAAGAAAGAAACTGG + Intronic
956766284 3:72487292-72487314 AAGAGAGCAAAGAAGGAACCAGG + Intergenic
956932409 3:74059897-74059919 AAGGAAACAAAGAAGGAAGCAGG + Intergenic
957031040 3:75241849-75241871 AATTGAGCAAAGAGTGAATCAGG - Intergenic
957813264 3:85256066-85256088 AATCAAGTGAAAAAGGAACCAGG - Intronic
957988734 3:87604466-87604488 AATTAAGAAAACAAGTTACCTGG - Intergenic
958870312 3:99550900-99550922 AATTAGTCAATGAGGGAACCAGG + Intergenic
959740666 3:109715590-109715612 AATTAAATAAAAAAAGAACCTGG + Intergenic
959836405 3:110923588-110923610 TTCTAAGCAAAGAAGGAATCAGG + Intergenic
960389727 3:117062734-117062756 AATGAAGCAATGAAAGAAGCAGG - Intronic
961334823 3:126167246-126167268 CAATAAGGAAAAAAGGAACCAGG + Intronic
963088708 3:141462304-141462326 AACTAAACAAAAAAGGAAGCGGG + Intergenic
963575725 3:147059089-147059111 AACAAAGCAAAGAAGGAATGAGG - Intergenic
964165436 3:153699174-153699196 AAGTAAGCAAACTAGCAACCTGG + Intergenic
964209142 3:154209259-154209281 AATGAACTAAATAAGGAACCAGG - Intronic
964282122 3:155079165-155079187 AAGGAAGGAAAGAAGGAAACGGG + Intronic
964287003 3:155128985-155129007 AGTTTAGCAAAGAAGTAACTGGG - Intronic
965374752 3:167909430-167909452 AATAAAGCAAAAAAGTAAACTGG + Intergenic
966861222 3:184231737-184231759 AATGAATCAATGAAAGAACCAGG - Intronic
967019044 3:185506538-185506560 AATAAAACTAAGAAGAAACCAGG + Exonic
967633057 3:191769504-191769526 AATGAAGTAAATAAGGCACCAGG - Intergenic
971827871 4:31650417-31650439 AACTAAAAAAAGAAGGAACCAGG - Intergenic
971922764 4:32964277-32964299 AATTTAGCAAAGAAAAAACGTGG + Intergenic
973804751 4:54514900-54514922 AATGAAGGAAAGAAGGAAGGAGG - Intergenic
973988108 4:56375669-56375691 AATGAAGCAGATAAGGAATCTGG - Intronic
974251105 4:59384463-59384485 AATTAAGCACTGAAGGATTCAGG - Intergenic
974332858 4:60502841-60502863 AATCAAGCAAACAAGTAAGCAGG - Intergenic
974570062 4:63634053-63634075 AATAAAGCAAAGAAAGAATTTGG - Intergenic
974586407 4:63884664-63884686 TCTTAAGCAAAGAAGGAATAAGG + Intergenic
974593126 4:63982339-63982361 AATTAAGTAAATATGGTACCAGG - Intergenic
974729410 4:65842658-65842680 AATTTGGCAAAGAAAGAACTAGG + Intergenic
976633263 4:87261262-87261284 AAATAAATAAAGAAGGAAGCTGG + Intergenic
977154043 4:93551254-93551276 AATAAAGCATAGAAGGAGACAGG + Intronic
977718065 4:100206391-100206413 AATTAAGCAAAGAACAATGCAGG - Intergenic
978227832 4:106359777-106359799 GAGTAAGGAAAGAAGGAATCTGG + Intergenic
979340321 4:119514873-119514895 CATTATACAAAGAAGGAAACAGG + Intronic
979413604 4:120407927-120407949 AATTAACTAAATAAGGTACCAGG + Intergenic
979433236 4:120657802-120657824 AAATAAGTAAATAAGGAAACAGG + Intergenic
980258159 4:130409297-130409319 AATTAAGCAATGAAAGAAAGCGG - Intergenic
980590393 4:134879969-134879991 AATTACGAAAAGAGGGAATCAGG + Intergenic
981147574 4:141343140-141343162 AAGGAAGAAAAGAAGGAAACTGG + Intergenic
982314726 4:154020643-154020665 AAAGAAGCAAGGAAGGATCCTGG - Intergenic
983473291 4:168183261-168183283 ATTTATGCAAAGGAAGAACCTGG + Intronic
984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG + Intergenic
985811229 5:2088461-2088483 GATTAAGAAAAGTAAGAACCAGG + Intergenic
985905033 5:2827883-2827905 AAGGAAGCAAAGAAGGAAGGAGG + Intergenic
986233650 5:5887560-5887582 AATCAAGCAATGCAGGGACCTGG - Intergenic
986716930 5:10531553-10531575 ACTTAACCAATGAAGAAACCAGG - Intergenic
987958537 5:24772267-24772289 AAATAAGCCTAGAAAGAACCAGG + Intergenic
988430957 5:31117922-31117944 AATTAAGTAAAGAATGCATCAGG + Intergenic
988907561 5:35804805-35804827 AATTAAGCAAAGAAGGAACCTGG - Intronic
989189286 5:38654644-38654666 AATGAAGCCAAGAAGAAACAAGG + Intergenic
989488183 5:42016490-42016512 AATTATGCCGAGAAGGACCCAGG - Intergenic
990934800 5:61136564-61136586 AATTAAGTAAAGAAGCCACAAGG - Intronic
991357183 5:65780974-65780996 AATTAAGTGAAGAAAGACCCAGG - Intronic
991639661 5:68739720-68739742 AATTAAGCAAAGGAAAAATCAGG + Intergenic
991725309 5:69529932-69529954 AATTAAGGACAGAAGAAAGCAGG - Intronic
993699448 5:91100471-91100493 AAAAAAGGAAAGAAGGAAGCAGG + Intronic
994893433 5:105669476-105669498 AATGAATCAAACAAGGTACCAGG - Intergenic
995278414 5:110306209-110306231 AATGAACTAAAGAAGGCACCAGG - Intronic
995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG + Intergenic
995905599 5:117118919-117118941 ATATAAGCAAAGAAGTAGCCTGG + Intergenic
997574483 5:134963699-134963721 ACTTTAGCAAAGAAGGAAACAGG - Intronic
997904431 5:137801297-137801319 AAATAATCCAAGAAGGAACGGGG + Intergenic
999103792 5:149050742-149050764 AATTGGGAAAAGAAAGAACCTGG + Intronic
1002847906 6:964936-964958 TATTAAGAATAGAAGGAACTTGG - Intergenic
1004149977 6:13107473-13107495 AATTCAGCAAAGAAGCCATCTGG + Intronic
1004451178 6:15748180-15748202 AATTGAGCAAATAAGTAAACAGG + Intergenic
1004973009 6:20933007-20933029 AGTTAATCAATGAAGGAGCCAGG + Intronic
1005810297 6:29510078-29510100 CATTTAGCAAAGCAGGAAACAGG + Intergenic
1008902370 6:56635713-56635735 AACTAAGGAAAGATGAAACCTGG + Exonic
1009693241 6:67062885-67062907 AATTCAGCAATGAAGTCACCGGG + Intergenic
1010151836 6:72741735-72741757 AATTAAGAAAAGAACGATTCAGG + Intronic
1010552712 6:77242867-77242889 AATTAAGGAAAGAAGGGACAGGG + Intergenic
1010716485 6:79235306-79235328 AATTAGGAAAAGAAAGAACAAGG + Intergenic
1011013417 6:82727401-82727423 AGTTAAGTAAAGAAGGAAGAAGG - Intergenic
1011044010 6:83062029-83062051 AATTAAACAAAAAAGGAATGGGG - Intronic
1011106753 6:83790444-83790466 AATGTAGCAAAAAAAGAACCTGG + Intergenic
1012795530 6:103755491-103755513 AATTAATAACAGAAGGAAACTGG + Intergenic
1013216627 6:108033222-108033244 AATCAAGAAAAGAGGGAAACAGG - Intergenic
1013962018 6:115912026-115912048 AAATAAGCAAGGAAGGAAAGGGG - Intergenic
1014229467 6:118887108-118887130 AATTCTGCAAAGAAGCCACCTGG - Intronic
1014349959 6:120328638-120328660 AGGTAAGCAGAGAAGAAACCTGG - Intergenic
1014425063 6:121294139-121294161 GAATAAGCAAAGAAGGATCACGG + Intronic
1016521075 6:144947546-144947568 AATAAAGCAGAGAAGGAAACAGG - Intergenic
1016836540 6:148482982-148483004 AATTAAGAAAAGTTTGAACCAGG - Intronic
1017744128 6:157431669-157431691 AATAAACCAAAGAAGTTACCTGG + Intronic
1019312554 7:369775-369797 CATTAAACAGATAAGGAACCGGG + Intergenic
1020369975 7:7421478-7421500 AATAAAGAAAAAAAAGAACCAGG + Intronic
1021353870 7:19629255-19629277 AATGAACTAAATAAGGAACCAGG + Intergenic
1021794519 7:24240516-24240538 CATTAAGCAGAGAAGGGAACTGG + Intergenic
1021845528 7:24758755-24758777 AATAAAGCAGAGGAGGAACTAGG - Intergenic
1022983621 7:35628046-35628068 AATTATGCAAATAAGGAATGTGG - Intergenic
1024654869 7:51443413-51443435 AATTGAGCAAAGAATGATTCTGG + Intergenic
1025922312 7:65924970-65924992 AGTTAAGCAAAGGACCAACCAGG - Intronic
1026456681 7:70578810-70578832 GCTTAACCAAAGAAGGACCCAGG - Intronic
1026456748 7:70579478-70579500 AATAAAGCAAATAAGGAACAGGG - Intronic
1027691875 7:81357785-81357807 AATTAAGTAAGTAAGGAACTGGG - Intergenic
1027814749 7:82954027-82954049 AAGAAAGCCAAGAAGGAAACTGG - Exonic
1028033444 7:85949114-85949136 AATCAAGTAAATAAGGCACCAGG - Intergenic
1029408033 7:100389611-100389633 AATGAAGGAAAGAAGGAAGGAGG + Intronic
1029844156 7:103395856-103395878 GATGAAGCAAAGAAGTAACATGG + Intronic
1030206993 7:106960695-106960717 AATTAAGGTAAGGAGGAATCGGG - Intergenic
1031295229 7:119993635-119993657 AAATAAGCAAATAAGGAAATGGG - Intergenic
1031485603 7:122319669-122319691 AATTAAGTACAAAACGAACCTGG + Intronic
1031688482 7:124761544-124761566 TATTAAGGAAAGAAGAAAGCAGG - Intronic
1031758762 7:125682589-125682611 AATAAACTAAATAAGGAACCAGG + Intergenic
1032748948 7:134816890-134816912 AATAAAGCCAGGAAGGAAACAGG - Intronic
1032807357 7:135369641-135369663 AGTTAATCATAGTAGGAACCAGG - Intronic
1032928242 7:136634775-136634797 AATAAAGGAAATAAAGAACCAGG - Intergenic
1033121071 7:138667050-138667072 AAAAACGCAAAAAAGGAACCAGG + Intronic
1033591437 7:142812124-142812146 AATTAACCAATTAAGTAACCTGG + Intergenic
1033670403 7:143487565-143487587 GATTCAGCAAAGAAAGAATCCGG - Intergenic
1035908160 8:3536464-3536486 CATTAATCAAAGAGGAAACCTGG - Intronic
1036170537 8:6480097-6480119 AAAAAAGAAAAAAAGGAACCAGG - Intronic
1036474064 8:9077238-9077260 AATTAAGCAGGGAAGGAATGTGG - Intronic
1036675930 8:10833271-10833293 AATTAAGGAATGAAGGAAGTAGG + Intronic
1036776314 8:11615232-11615254 AGTTAAGCAAAGAGGCACCCTGG + Intergenic
1037667879 8:20986430-20986452 AATGAAGAAAAGAAGGAAACTGG + Intergenic
1037671687 8:21020520-21020542 AAATAAGCAAAGAGAGGACCTGG - Intergenic
1038096857 8:24322670-24322692 AATTAAGCAAGAAAGGAACAAGG + Intronic
1038564507 8:28608560-28608582 AAATAACCAAAGAAATAACCTGG + Intronic
1038676365 8:29626132-29626154 ACTTTGGCAAAGAAGGATCCTGG + Intergenic
1041875362 8:62681919-62681941 AAATGAGGAAAGAAGAAACCAGG + Intronic
1041947644 8:63464182-63464204 AATAAAGCACAGAAGGTGCCTGG - Intergenic
1042980405 8:74519877-74519899 AATGAACTAAAGAAGGCACCAGG + Intergenic
1043144845 8:76639982-76640004 AATTAACTAAATAAGGCACCAGG + Intergenic
1043159811 8:76832138-76832160 AATTAAACAAACAATTAACCTGG - Intronic
1043504071 8:80885739-80885761 GAACAAGAAAAGAAGGAACCAGG + Intergenic
1044635328 8:94318723-94318745 AATGAACCAAATAAGGCACCAGG - Intergenic
1045571936 8:103377157-103377179 AAATAAGCAAACAAGAAACCTGG + Intronic
1045807111 8:106175927-106175949 AATGAAACAAAGGAGAAACCCGG + Intergenic
1046036508 8:108848422-108848444 AATAAAGGAAAAAAGGAACAGGG + Intergenic
1046513156 8:115223944-115223966 AATTAAGGAAAGAAGAAAAGGGG + Intergenic
1047199316 8:122751333-122751355 TATTAAGGATAGAAGGATCCAGG + Intergenic
1047638123 8:126789093-126789115 AGTCAAGAAAAGAAGGAACAGGG - Intergenic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1048615176 8:136066499-136066521 ATTTTAGCAAACAAGGAACTAGG - Intergenic
1048747826 8:137634995-137635017 AGTTAAGTACAGCAGGAACCTGG - Intergenic
1048965175 8:139609687-139609709 AATTAAGCAAAGATTGCACAGGG + Intronic
1049046756 8:140158333-140158355 TATTAGGGAAAGAAGGAAGCAGG + Intronic
1051820251 9:21157369-21157391 AATTAAGAAAGAAAGGAACAAGG + Intergenic
1052340072 9:27356302-27356324 AATTGAGCAAGAAAGGTACCAGG - Intronic
1052914519 9:33914406-33914428 AATTAAGCAAGAGAGGCACCAGG + Intronic
1053025994 9:34728816-34728838 AAATAAGCAGAGAAGGAAAATGG - Intronic
1053037500 9:34837856-34837878 AAATAAGCAGAGAAGGAAAATGG - Intergenic
1053118158 9:35523952-35523974 AATTAAGAAAGGAAGGAAAAGGG + Intronic
1055295380 9:74827811-74827833 AATGAAGCTCAGAAGGAACCTGG - Exonic
1055339097 9:75262770-75262792 AATGAAGTAAATAAGGCACCAGG - Intergenic
1055693920 9:78862715-78862737 AGTTAAGCAAAGAAAAAGCCTGG - Intergenic
1056605098 9:88078821-88078843 AGGTGAGCAGAGAAGGAACCAGG + Intergenic
1056745368 9:89296725-89296747 AGTTAAGCTGAGAAGGAACTGGG - Intergenic
1059030231 9:110685409-110685431 TGCTAAGCAAAAAAGGAACCAGG - Intronic
1059846525 9:118283414-118283436 GATAAAGCAAAGAAGTAACAAGG + Intergenic
1062220478 9:135412585-135412607 AATTAAAAAAAGAAAGAACGGGG + Intergenic
1185615748 X:1420743-1420765 ATTGAAGCAAAGAAGAAACAGGG + Intronic
1185940079 X:4308063-4308085 AAGGAAGAAAAGGAGGAACCAGG - Intergenic
1187246039 X:17553694-17553716 GAATAAGGAAAGAAGGAAGCTGG - Intronic
1187474553 X:19599591-19599613 TAGTAAGCAAAGCAGGCACCTGG - Intronic
1189362364 X:40362674-40362696 AATTAATCCAAGAGGGAGCCGGG - Intergenic
1189454873 X:41177279-41177301 AATTATGCAATGTATGAACCTGG - Intronic
1189657865 X:43266232-43266254 AATGAACTAAATAAGGAACCAGG - Intergenic
1189769917 X:44415716-44415738 AATGAAGTAAATAAGGCACCAGG - Intergenic
1189827456 X:44934200-44934222 TATAAAGCAAAGAGGGAACCTGG - Intronic
1189923687 X:45930638-45930660 TATTAAGCAAATTAGGAACTGGG + Intergenic
1190015288 X:46821016-46821038 AATGAATGAAATAAGGAACCAGG + Intergenic
1190464443 X:50711979-50712001 CATTAAACAAATAAGGAAACAGG - Intronic
1191048980 X:56170331-56170353 AATGAACTAAATAAGGAACCAGG + Intergenic
1191983954 X:66958818-66958840 AATGAAACAAATAAGGCACCAGG - Intergenic
1192062305 X:67839867-67839889 AATTAACTAAATAAGGAATCAGG + Intergenic
1192135204 X:68590208-68590230 AATAAACTAAATAAGGAACCAGG + Intergenic
1192477375 X:71454584-71454606 AATTAAGCAGGGAAGGAAACAGG - Intronic
1192505476 X:71679352-71679374 AATGAACTAAAGAAGGCACCAGG - Intergenic
1192549533 X:72042877-72042899 AATGAAGGAAGGAATGAACCAGG + Intergenic
1193223888 X:78959003-78959025 CAAAAAGCAAAGAAGTAACCTGG - Intronic
1193466665 X:81855895-81855917 AATTTAGCAATGAAGCCACCAGG - Intergenic
1193597782 X:83468920-83468942 AATTCAGCAGTGAAGTAACCTGG - Intergenic
1193650466 X:84124296-84124318 AATGAACTAAATAAGGAACCAGG + Intronic
1193867326 X:86750919-86750941 AAGTATGAAAAGCAGGAACCTGG - Intronic
1194841551 X:98750768-98750790 AATGAACTAAATAAGGAACCAGG - Intergenic
1195732050 X:107977988-107978010 TATTTAGCAAACAAGGTACCTGG - Intergenic
1196336235 X:114539292-114539314 AATTAAGAAAAGAAAGGACAAGG - Intergenic
1196432853 X:115645685-115645707 TATTAAGAAAAAAAGGAACTAGG - Intronic
1196820131 X:119694588-119694610 GAAAAAGAAAAGAAGGAACCAGG + Intergenic
1196997679 X:121401963-121401985 AATGCAGCAAAGAAGAAACAAGG - Intergenic
1197190863 X:123646729-123646751 TGGTAAGCAAAGAAGGAACTGGG + Intronic
1197722277 X:129753344-129753366 AATGAAACAAAGAAGCAAGCTGG + Intronic
1197866697 X:131026716-131026738 AAGTAAGCCAAGGAGGAGCCAGG + Intergenic
1198155624 X:133957547-133957569 AAGTAAACAAAGAATTAACCTGG + Intronic
1198593838 X:138214682-138214704 AAATAAGTAAAGAAGCGACCTGG - Intergenic
1199018323 X:142846553-142846575 AATGAACTAAAGAAGGTACCAGG - Intergenic
1199066405 X:143423849-143423871 AATTCATCAAAGAAGCAATCAGG + Intergenic
1199154042 X:144525406-144525428 AATTAACTAAAGAAGGCATCAGG - Intergenic
1199904841 X:152214924-152214946 AATTAAGAAAATAAGCAACGTGG - Intronic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic