ID: 988913342

View in Genome Browser
Species Human (GRCh38)
Location 5:35868526-35868548
Sequence GCCATGACCAGTGTGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988913339_988913342 -4 Left 988913339 5:35868507-35868529 CCACACAGAAGCAGCATTGGCCA 0: 1
1: 0
2: 1
3: 17
4: 223
Right 988913342 5:35868526-35868548 GCCATGACCAGTGTGGGTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988913342 Original CRISPR GCCATGACCAGTGTGGGTCC TGG Intronic
900709688 1:4105739-4105761 TCCATGGCGAGTGTGGGTCTTGG - Intergenic
901277524 1:8004206-8004228 GCCAGGAGCAGTGTTGGTCTCGG + Intergenic
901493577 1:9608891-9608913 TCCATTACCAGAGTGGGTCGGGG + Intronic
901810780 1:11765902-11765924 GACATGACCAGTGGGTGCCCGGG + Exonic
902658760 1:17887176-17887198 GCCATGCACAGTGTGGGTGAAGG - Intergenic
903173356 1:21567021-21567043 CCCAGGACCAGCCTGGGTCCAGG - Intronic
903741427 1:25560716-25560738 GCCATGAGCAGCCTGGTTCCTGG + Intronic
904505901 1:30953713-30953735 CCCAAGACCAGCATGGGTCCAGG - Exonic
906102704 1:43273273-43273295 GCCATGGCCACTGTGGGTGGAGG - Exonic
906746669 1:48226633-48226655 CCCATGAACAGTGTGGGGCTTGG + Intronic
907108210 1:51903239-51903261 GCCAGAACCTGTGTGGGACCCGG + Intergenic
912511105 1:110190657-110190679 GACAAGCCCTGTGTGGGTCCTGG - Intronic
914961582 1:152213997-152214019 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914961830 1:152215407-152215429 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962077 1:152216817-152216839 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962327 1:152218227-152218249 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962451 1:152218932-152218954 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962691 1:152220333-152220355 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914984069 1:152441522-152441544 GCCATGACGAGTGGGGCTCTGGG + Intergenic
915146109 1:153796568-153796590 GCCAGGCCCAGTGTGGGCACTGG + Intergenic
921776923 1:219112046-219112068 GGCATGGCCAGGGTGGGGCCTGG - Intergenic
922347362 1:224707538-224707560 CCAATGAGCAATGTGGGTCCTGG + Intronic
922504328 1:226117910-226117932 GGCAGGACCAGAGTGGGTCTAGG + Intergenic
923130894 1:231073818-231073840 GCCAGGACCAGTGTGTGGTCAGG - Intergenic
1062910439 10:1208621-1208643 GCCAGGCCCACTGGGGGTCCAGG - Intronic
1062965925 10:1607791-1607813 GTCATGTCCAGTGTGGGTGATGG - Intronic
1063264042 10:4426112-4426134 GCCATCCCCAGTGTGGGGCCTGG + Intergenic
1066961312 10:42230512-42230534 AGCATGGCCAGTGTGGGGCCTGG + Intergenic
1067278883 10:44856602-44856624 GCAATGACCAGTATGGAACCAGG + Intergenic
1068963894 10:62892777-62892799 GCCCTGAGCTGTGTGGGTGCCGG - Intronic
1069792828 10:71034164-71034186 ACCATCAGCAGTGTGTGTCCTGG - Intergenic
1069957832 10:72062495-72062517 GCCAGGAGCAGTGTGGATCAAGG + Exonic
1070622985 10:78028350-78028372 GCAATGACAAGGGTAGGTCCAGG - Intronic
1070677826 10:78424671-78424693 CACATGACCAGTGTTAGTCCTGG - Intergenic
1071919398 10:90332309-90332331 GCCATCACCAGTGAGGCACCAGG - Intergenic
1074032076 10:109698990-109699012 GCCATCTCCAATGTGTGTCCTGG + Intergenic
1074229559 10:111520316-111520338 GGCATCACCAGTGTGGGTGGAGG - Intergenic
1075261873 10:120970265-120970287 ACCATGACCAGTGAGGGCTCAGG - Intergenic
1076309431 10:129493689-129493711 GCCAGGCCCAGTGTGGGATCTGG + Intronic
1077008778 11:370885-370907 CCCTTGGCCTGTGTGGGTCCAGG - Intronic
1078508240 11:11967517-11967539 GCCATGCCCTGTGTGGCTGCAGG - Intronic
1078898670 11:15621321-15621343 GCAATGAGCAGGCTGGGTCCAGG - Intergenic
1081752789 11:45524053-45524075 GCCTTGACCAGTGGAGGTTCTGG + Intergenic
1081755284 11:45540022-45540044 ATCATGACCAGCCTGGGTCCTGG + Intergenic
1082796390 11:57381068-57381090 GGCAGGACCAGTGTAGGCCCTGG - Intronic
1085206365 11:74734912-74734934 ACCTTTACCAGTCTGGGTCCCGG + Intergenic
1100797625 12:98198907-98198929 GAGATGGCCAGTGTGGGTTCTGG - Intergenic
1102602815 12:114045609-114045631 GCCATGACGGGTGTGCTTCCAGG - Intergenic
1104021346 12:124994171-124994193 GGCCTGACCAGTGCGGGTCTGGG + Intronic
1104122740 12:125814623-125814645 ACCATGAATAGGGTGGGTCCTGG + Intergenic
1104345990 12:127999089-127999111 GTCATGACCAGTGTGAGTGATGG + Intergenic
1104722424 12:131052269-131052291 GCCCTGACCAGGGTGGGACTCGG - Intronic
1107977585 13:45704738-45704760 GCCATTACTAGTGGGGTTCCTGG - Intronic
1113369117 13:109706430-109706452 CCCATTGCCAGTGTGGGGCCCGG - Intergenic
1119765829 14:77187180-77187202 GCCATGGCCAGTCTGTGTCCAGG + Intronic
1123443712 15:20306854-20306876 AGCATGGCCAGTGTGGGGCCTGG - Intergenic
1125675949 15:41502693-41502715 GCCAAGCACAGCGTGGGTCCCGG + Intronic
1125967606 15:43886931-43886953 TCCATTTCCAGTGTGGGTGCAGG + Intronic
1128358333 15:66943667-66943689 TCCATGTCCAGTGTGTGTCAGGG + Intergenic
1129264780 15:74387735-74387757 GGCAAGTCCAGTGTGGCTCCAGG + Intergenic
1133631926 16:7629919-7629941 CCAGTGTCCAGTGTGGGTCCAGG + Intronic
1134006578 16:10822237-10822259 GCCAAGACCAGTGTGGGTAGGGG - Intergenic
1136643794 16:31591212-31591234 GAGATGACCAGAGTGGGCCCAGG - Intergenic
1136661810 16:31769555-31769577 GAGATGACCAGGGTGGGCCCAGG + Intronic
1136840819 16:33543013-33543035 AGCATGGCCAGTGTGGGGCCTGG + Intergenic
1137538323 16:49344308-49344330 GCCATGAGAAGTGAGGATCCAGG - Intergenic
1139594524 16:67950115-67950137 GCCATGAAGATTCTGGGTCCAGG + Intronic
1140969788 16:80001862-80001884 GCCATTCACAGTGTGAGTCCAGG + Intergenic
1141587872 16:85047202-85047224 TCCATGGCCTGTGTGGGCCCCGG + Intronic
1203150984 16_KI270728v1_random:1843310-1843332 AGCATGGCCAGTGTGGGGCCTGG + Intergenic
1142714020 17:1738219-1738241 GCCCTGGCCAGTGTGGGACCGGG + Exonic
1142889261 17:2932396-2932418 CCCATAACAAGTGTGGGACCCGG + Intronic
1143518203 17:7430381-7430403 GCCATGACCAGTGCTGGAGCAGG - Intergenic
1143623535 17:8095069-8095091 GCCATGACCAGGGTTGGGTCAGG + Intergenic
1143639266 17:8186308-8186330 CCCATGACCACTGTGCGCCCTGG - Intergenic
1144468325 17:15515098-15515120 GCCATGCCCACTGTGGGTATGGG - Intronic
1144659773 17:17060437-17060459 GCCAGGGCCAGTGTGGAACCAGG + Intronic
1145059065 17:19720927-19720949 GCCAAGTACAGTCTGGGTCCAGG + Intergenic
1146054804 17:29575741-29575763 GCTAGGGGCAGTGTGGGTCCAGG - Intronic
1148847636 17:50538583-50538605 GCCATTACCTCTGTGGATCCAGG + Intronic
1150770087 17:68033527-68033549 GCCATAAGCAGTCTGGTTCCAGG - Intergenic
1152305773 17:79519430-79519452 GCCAGGACCAGGGTGGGTACGGG + Intergenic
1152822829 17:82445853-82445875 GCCACGACCAGGGTGAGTCGTGG - Exonic
1155237369 18:23834136-23834158 GTCATCACCAGTGTGGGTATTGG + Intronic
1157112261 18:44832526-44832548 GCCATGACTAGTTTGCATCCTGG - Intronic
1157621764 18:49021051-49021073 GGCTCGTCCAGTGTGGGTCCCGG + Intergenic
1158214368 18:55084070-55084092 GCCATGGCCAGAGTCAGTCCTGG + Intergenic
1160043914 18:75369499-75369521 GCCATGAGCACTGTTTGTCCTGG + Intergenic
1160461741 18:79043874-79043896 ACCAGGAACGGTGTGGGTCCTGG + Intergenic
1161604396 19:5206678-5206700 GCCCTGCCCACTGGGGGTCCAGG + Exonic
1163513834 19:17751358-17751380 CCCATGGCCTGTGTGGTTCCAGG + Intronic
1163776822 19:19223884-19223906 GCCAGGCACAGTGTGGGTCGAGG - Intronic
1165730159 19:38140098-38140120 GCCATGAACGGGGTGGCTCCAGG + Intronic
1166752117 19:45169226-45169248 GCACTTACCAGTGTGGGACCTGG + Intronic
1167384056 19:49153820-49153842 TCCTTGACCACTGTGTGTCCTGG + Exonic
1168585053 19:57585006-57585028 GCCAGGACCAGTGAGGGCCTGGG - Intronic
926203314 2:10816876-10816898 CACATGCCCAGTGTGGGTCTTGG - Intronic
927862941 2:26571341-26571363 GCCATTCCCAGGGTGGGTACTGG - Intronic
929211647 2:39364213-39364235 GCCATGACCATTCTGCTTCCTGG - Intronic
930422021 2:51165796-51165818 GCTGTGACCAGTGTGGGGGCTGG + Intergenic
932421339 2:71603235-71603257 CCAAGGACCAGTTTGGGTCCTGG + Intronic
932767986 2:74483147-74483169 GACAAGACCAGTGGGGGTCTAGG + Intronic
934323612 2:91986581-91986603 AGCATGCCCAGTGTGGGGCCTGG - Intergenic
937038478 2:118802244-118802266 GCCATGAACAGAGTTGGTGCTGG + Intergenic
937511027 2:122595122-122595144 GACATGACCACTGCAGGTCCTGG + Intergenic
937693732 2:124784761-124784783 GCCATGTCCAGTGTGACTCCAGG + Intronic
938131964 2:128724375-128724397 GCCATCAACACTGTGTGTCCTGG - Intergenic
942891312 2:180992494-180992516 GTGAAGACCACTGTGGGTCCAGG + Intronic
943171175 2:184402484-184402506 TCCATGACCAGTGTTCATCCAGG + Intergenic
948330442 2:237160448-237160470 GCCAAGACCAGGGTGGGGCAAGG + Intergenic
948803008 2:240441337-240441359 GACCTGACCAGTGTGGCTTCGGG - Intronic
1169142678 20:3235054-3235076 GCCATGTCCTGTGTGGGGCTGGG - Intronic
1170538694 20:17366467-17366489 GCCAGGCACAGTGTCGGTCCTGG - Intronic
1171023709 20:21609752-21609774 GCCATGACCACAGTGGGTTGGGG + Intergenic
1175049172 20:56137339-56137361 TCCAGAACCAGTGTGGGTTCTGG - Intergenic
1175895301 20:62333313-62333335 GCCAGGCACAGTGGGGGTCCAGG + Intronic
1176099270 20:63357579-63357601 GCCATCACCAGGGTCTGTCCTGG - Intronic
1176151860 20:63595560-63595582 GCCATGGCCAGGGTGGGGCTGGG + Intronic
1179577198 21:42315370-42315392 GCCATGACCACCGTGGGCTCCGG + Exonic
1180550380 22:16532468-16532490 AGCATGGCCAGTGTGGGGCCTGG - Intergenic
1181047653 22:20223231-20223253 GCGATGCCCAGTGTGGGCTCAGG - Intergenic
1181437070 22:22917283-22917305 GGCATGTGCAGTGTGGGGCCTGG - Intergenic
1182476962 22:30581662-30581684 TGCATGAGCAGTGTGGGTGCAGG + Intronic
1183718748 22:39549947-39549969 GCCAGGCCCAGTTTGGGCCCTGG - Intergenic
1184123869 22:42472904-42472926 GCCATGGCCAGGGCGGTTCCTGG - Intergenic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185310544 22:50151872-50151894 GCCTTGTCCTGTGTGGGGCCTGG + Intronic
950448000 3:13049121-13049143 ACCATGCCCAGTGTGGGTTCTGG - Intronic
951811485 3:26705535-26705557 GCCATTACCAGTGTGACCCCAGG + Intronic
953180472 3:40589962-40589984 GCTGTGATCAGTGTGGGTGCAGG + Intergenic
953654312 3:44836938-44836960 GCCATGACAGGTGAGGGGCCTGG + Intronic
954454135 3:50587944-50587966 GCCAGGACCACAGTGGGCCCAGG + Intergenic
961324921 3:126104301-126104323 CCCATGACAAGTGTGAGGCCTGG + Intronic
962504078 3:136028226-136028248 GGCATGACAAGTGAGGGTTCAGG - Intronic
963721782 3:148869719-148869741 GCCATGCCCAGTCTGGGCCCTGG + Intronic
963782009 3:149495811-149495833 GCCATCATCAATGTGGTTCCTGG + Intronic
964246450 3:154659657-154659679 GCCAAGACAAGTATGGGGCCTGG - Intergenic
965611988 3:170554201-170554223 GCCATGCCCAGCATGGTTCCCGG - Intronic
968609564 4:1550915-1550937 GCCATGGCCAGTGCAGGGCCTGG + Intergenic
968707454 4:2086776-2086798 GCCAAGACCACTGCTGGTCCCGG - Intronic
974589238 4:63921822-63921844 GCCATGACCAGTTTCTGTCTTGG + Intergenic
982398508 4:154940086-154940108 GCCAGGAACAGTGTAGGTGCAGG - Intergenic
985358585 4:189147481-189147503 GCCATGTCAAGTGTGGGCCTCGG + Intergenic
985663636 5:1169897-1169919 GCCATGACCGGTGTGAGACATGG + Intergenic
988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG + Intergenic
988913342 5:35868526-35868548 GCCATGACCAGTGTGGGTCCTGG + Intronic
990157953 5:52901003-52901025 GCCATGCAAAGTATGGGTCCAGG - Intronic
996548314 5:124704669-124704691 GCCATGAGGAATGTGGGCCCAGG - Intronic
1005976591 6:30804840-30804862 CCTGTGACCAGTGTGGGTCGGGG - Intergenic
1006911774 6:37567902-37567924 GCCATGCCCAGTGTGTCCCCAGG - Intergenic
1011082975 6:83509757-83509779 GCCATGACCACTGTCAGGCCTGG - Intergenic
1012248217 6:96951218-96951240 GCCAGGACCAGCTTGGGTTCAGG + Intronic
1014307267 6:119758129-119758151 GGCATAACCAGAGTGGTTCCAGG + Intergenic
1017854526 6:158338733-158338755 GCCAGGACCAGAGAGGGACCAGG + Intronic
1019209713 6:170395166-170395188 GCCATGGCCTGCATGGGTCCAGG + Intronic
1019360926 7:603849-603871 GCCCTGTCCATTCTGGGTCCTGG - Intronic
1022544463 7:31173263-31173285 GCCCTGCCCTCTGTGGGTCCTGG - Intergenic
1024678674 7:51661143-51661165 GCAATGCCCATGGTGGGTCCAGG + Intergenic
1025235095 7:57228948-57228970 ACCAGGACCACTGTTGGTCCTGG + Intergenic
1032071900 7:128812969-128812991 GCCATGACCTCTATGGCTCCAGG - Intronic
1035119571 7:156555199-156555221 CCCAGGACCAGGGTGGGCCCAGG + Intergenic
1037376746 8:18238424-18238446 GCCACGACCAGTAGTGGTCCAGG + Intergenic
1037571987 8:20165640-20165662 GTCCTGACGAGAGTGGGTCCTGG - Intronic
1043886175 8:85603225-85603247 GCCATGACTATTGTATGTCCTGG - Intergenic
1044626672 8:94240915-94240937 GCAATGAACAGGGTGGGTTCTGG - Intergenic
1045283107 8:100766533-100766555 GCCAGGAACAGAGTGGGGCCAGG - Intergenic
1047516500 8:125559156-125559178 GCAATGACCACTGAGGGTCTCGG - Intergenic
1049657612 8:143805661-143805683 CCCGTGGCCAGTGTGTGTCCTGG - Intronic
1050911494 9:11077443-11077465 TCCAAGACCAGTGTGGCCCCAGG + Intergenic
1051189210 9:14493171-14493193 GCCTTAACGAATGTGGGTCCTGG - Intergenic
1057131148 9:92655494-92655516 GCAATGAGCAGTCTGGCTCCAGG - Intronic
1057829807 9:98397815-98397837 GCCATGTCCTGTGTGTGTCCAGG + Intronic
1059464637 9:114460107-114460129 CCCAAGCCCAGTGTGGTTCCTGG - Intronic
1060214496 9:121730531-121730553 CCCTGGGCCAGTGTGGGTCCAGG + Intronic
1061467540 9:130793701-130793723 ACCATGACCAGTCTGTGGCCTGG - Intronic
1062711207 9:137976091-137976113 GCCATGCCCAGTGTGGGCTGGGG + Intronic
1062715944 9:138010134-138010156 GCCAGGAAGAGTCTGGGTCCTGG + Intronic
1186399576 X:9244686-9244708 GCCATGAGCAGGCTGGGGCCCGG + Intergenic
1191077295 X:56468870-56468892 GCCATGACCACTGTGGGGGATGG + Intergenic
1194191978 X:90848597-90848619 GCCATGACCACTGTGGGAGATGG + Intergenic
1194278218 X:91913528-91913550 GCCATGACCACTGTGGAGCATGG - Intronic
1195275457 X:103276378-103276400 GCAAAGACCAGAGCGGGTCCAGG - Intronic
1197864069 X:130999413-130999435 GCTATGGCCAGTCTGTGTCCTGG + Intergenic
1200538613 Y:4431032-4431054 GCCATGACCACTGTGGGAGATGG + Intergenic
1200595555 Y:5135603-5135625 GCCATGACCACTGTGGAGCATGG - Intronic
1200973100 Y:9177459-9177481 GCCATGGCCAGAGTGGGCCATGG + Intergenic
1201191020 Y:11441561-11441583 AGCATGGCCAGTGTGGGGCCTGG - Intergenic