ID: 988918489

View in Genome Browser
Species Human (GRCh38)
Location 5:35919858-35919880
Sequence CAGTGGGTATGGGGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988918478_988918489 29 Left 988918478 5:35919806-35919828 CCATTGACTGTAGACTGGTTCCC 0: 1
1: 0
2: 1
3: 13
4: 107
Right 988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG 0: 1
1: 0
2: 2
3: 38
4: 419
988918483_988918489 8 Left 988918483 5:35919827-35919849 CCAGTGGAAAGGCTGGTAGAGAC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG 0: 1
1: 0
2: 2
3: 38
4: 419
988918482_988918489 9 Left 988918482 5:35919826-35919848 CCCAGTGGAAAGGCTGGTAGAGA 0: 1
1: 0
2: 4
3: 20
4: 176
Right 988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG 0: 1
1: 0
2: 2
3: 38
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988918489 Original CRISPR CAGTGGGTATGGGGTGAAGA TGG Intronic
900141598 1:1141291-1141313 GCGGGGGGATGGGGTGAAGAAGG - Intergenic
900154054 1:1197049-1197071 CAGTGGGCTCGGGGTGAGGAGGG + Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
901490540 1:9594334-9594356 CAGGGGGTGTGGGGTGAGAAGGG + Intronic
901819623 1:11819297-11819319 CAGTGGGACTGGGCTGGAGAAGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902792016 1:18775809-18775831 CAGGGGATCTGGGGTGAAGCTGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
904213307 1:28899878-28899900 CAGCTGGTAAGGGGTGAAGCTGG - Intronic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904392883 1:30197372-30197394 CAGTGGGTAAGGGGTGGAGCAGG - Intergenic
904617520 1:31757969-31757991 GAGTGGGTAAGGGCTGAGGATGG + Intronic
905663744 1:39749097-39749119 CAGTTGGCATGTGGTGACGAGGG + Intronic
905829127 1:41050134-41050156 CAGTGGGGAAGGGGTGCAGTGGG + Intronic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906233694 1:44188998-44189020 CAGTGAGTATGTGGTGGTGATGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910294149 1:85627871-85627893 CACAGGGTATGGGGTGGTGATGG + Intergenic
910589793 1:88918543-88918565 CAGTGGGCCTGGTGTGTAGATGG + Intergenic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
911931202 1:103906112-103906134 CAGTGGGTTGGGGGTGAACTTGG - Intergenic
912801994 1:112725527-112725549 CAGTGGGAATGGGGTGGGGGTGG - Intronic
914340547 1:146756226-146756248 CAGGGTGTATGGGGTGGGGAGGG - Intergenic
915253086 1:154604414-154604436 CAGTGGGCCTTGGGTGGAGAAGG - Intronic
915887658 1:159740473-159740495 CAGAGGGTCTGGGGATAAGATGG + Intergenic
915909892 1:159908440-159908462 CAGTGAGAATGGGTTGAAAATGG - Intergenic
916001592 1:160621645-160621667 CAGTGTGTATGTGGTGAGCATGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917574609 1:176308050-176308072 CATTAGGTAGGAGGTGAAGAAGG + Intergenic
918739153 1:188104794-188104816 CAGTGGGTAAGGGGAGGACAGGG + Intergenic
919037881 1:192339599-192339621 CAGAGGAGATGGGGTTAAGAGGG - Intronic
919452248 1:197786372-197786394 GTGTGGGTATGGGGTGAGAAAGG + Intergenic
919924601 1:202185903-202185925 CAGGGGGCATGGGGTGAGGCAGG - Intergenic
921822101 1:219629162-219629184 AAGAGGGTATTAGGTGAAGAAGG + Intergenic
922095441 1:222439461-222439483 CACTGGGAATGGGGGGACGAGGG - Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923462013 1:234215858-234215880 CAGTTGGTAGGTGGTGAAGCAGG + Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
923625011 1:235606708-235606730 CAGGGAGTTTGGGCTGAAGACGG + Intronic
924448479 1:244156294-244156316 CAGTGGGTAGAGGGTGAGGGAGG - Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1065513227 10:26500311-26500333 CTGTGACTTTGGGGTGAAGACGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1067630316 10:47959134-47959156 CAGAGGGTAGGGGGAGAACATGG + Intergenic
1068778906 10:60898480-60898502 CAGTGTGTATGAGATGCAGAGGG + Intronic
1069080341 10:64081880-64081902 CTGTAGGTATGGGGTGGTGAAGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070352180 10:75603211-75603233 AAGTGGATTTCGGGTGAAGAAGG + Intronic
1071014974 10:80986416-80986438 TGGTGGGAATGGGGTGAGGAGGG - Intergenic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072181555 10:92986525-92986547 CATTGTGTATTTGGTGAAGAGGG + Intronic
1072729004 10:97832191-97832213 CAGTGGGCATGAGCTGAAGCTGG + Intergenic
1073310220 10:102534989-102535011 CAGGGGGTAGGGGGTGGAGGTGG - Intronic
1074430128 10:113387274-113387296 TGGTGGGGATGGGGTGAGGAGGG - Intergenic
1075380449 10:122014552-122014574 CACTGAGCATGGGGTGGAGAGGG - Intronic
1076273703 10:129178487-129178509 CAGTGTGGAGGGGGTGCAGAGGG - Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077573270 11:3356907-3356929 GAGCGGGTATGAGGTGGAGATGG + Intronic
1078109418 11:8380601-8380623 AAGTGGGCATGTGGTGAAAAGGG + Intergenic
1078280079 11:9892475-9892497 CAGAGGAAATGGGGTGAAGGTGG + Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1079890282 11:26043108-26043130 AAGAGGGGATGGGGTCAAGATGG - Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081416029 11:42817383-42817405 CATAGGGAATGGGGTGAAGGTGG - Intergenic
1082998137 11:59268759-59268781 CAGTGGGTGCTGGGTGATGAAGG + Intergenic
1083285528 11:61656434-61656456 CAGGGGGTGTGGGGTGGTGAGGG + Intergenic
1083830115 11:65226027-65226049 CAGTGTGTCTGGGGTGAGGTGGG + Intergenic
1084089370 11:66870173-66870195 GACTGGGGATGGGGAGAAGAGGG - Intronic
1087141903 11:94772363-94772385 GAGTGAGGATGGGGAGAAGAGGG - Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1088510760 11:110571987-110572009 AAGTGTGTATGGGGTGGAGGAGG - Intergenic
1088920804 11:114258567-114258589 CAGAGGGTCTGGGCTGAAGCAGG - Intronic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089181181 11:116583879-116583901 CATTGGGAGTTGGGTGAAGATGG - Intergenic
1091209292 11:133842915-133842937 CAGTGGGTGTGGGGTGATGCAGG - Intronic
1092280843 12:7096708-7096730 CAGTGGGTTTGGCATGGAGATGG - Exonic
1093163236 12:15774316-15774338 CAGGGGGGGTGGGGTGAAGGAGG - Intronic
1093518153 12:20015757-20015779 CAGAGAGAATGGTGTGAAGATGG - Intergenic
1094265526 12:28555019-28555041 AAATGGGAATGGGGTCAAGAGGG + Intronic
1095085793 12:38056520-38056542 GAGGGGGTGTGGGGTGAGGACGG - Intergenic
1095267932 12:40181536-40181558 CAGTGGGTGTGTGGTGGGGAAGG + Intergenic
1095554085 12:43480312-43480334 CAGTGTGTGGGGGGTAAAGAAGG + Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096806800 12:54145852-54145874 CAGTTGGTTTGGTGTGGAGAAGG - Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1097529588 12:60781313-60781335 GCCTGGGAATGGGGTGAAGATGG - Intergenic
1098477770 12:70925159-70925181 CAGTTGGTAAGTGGTGAAGCTGG + Intergenic
1098731801 12:74044770-74044792 CAGTGTGGATGTGGTGAAAAGGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104908243 12:132226942-132226964 CAGTGTGTATGGGGTGTATGTGG - Intronic
1105580733 13:21693361-21693383 CTGTGGGTATTGGGTGGACATGG + Intronic
1106506357 13:30373870-30373892 AGGTGGGGAAGGGGTGAAGATGG - Intergenic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1109144967 13:58768219-58768241 CAGTGGCTAGGGGGAGAAGGAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1116396715 14:44455478-44455500 CAGTTGGTCTGGTGTTAAGATGG - Intergenic
1116604082 14:46967604-46967626 CAGTGGGTAAGGATTGATGAAGG - Intronic
1116760741 14:49010178-49010200 CAGTGGGTATCGGGTAAATAGGG - Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1118765722 14:68908175-68908197 CAGTGTGTATGGGGTGGGGGTGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1120949120 14:90024572-90024594 CAGTGGGTATTGTGTGCAGTAGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122030544 14:98908404-98908426 CATTTGGCATGGGGTGAAGCAGG + Intergenic
1122438182 14:101712926-101712948 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438229 14:101713094-101713116 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438327 14:101713462-101713484 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122529439 14:102415557-102415579 GCGTGGGGATGGGGTGAGGAGGG + Intronic
1124157981 15:27244913-27244935 CAGTGTGTATGGGGTGGTCATGG + Intronic
1124861589 15:33447432-33447454 AAGTGGGCATGGGGTGGGGAAGG - Intronic
1125432982 15:39615784-39615806 CAGTGGCTGGGGGATGAAGAGGG + Intronic
1126590107 15:50330569-50330591 AAGTGTGTATGGGATGAGGAAGG - Intronic
1127634753 15:60858573-60858595 CAGCGGGGATGGGGTGAAGCAGG + Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129236691 15:74228004-74228026 CAGAGGTAATGGGGTGGAGATGG - Intergenic
1129897039 15:79116151-79116173 CAGTGCGTATGGGGGGAGGGGGG - Intergenic
1130353531 15:83110739-83110761 CTGTGGGGATGAGCTGAAGAAGG - Intronic
1130468289 15:84203721-84203743 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130485460 15:84396021-84396043 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130495977 15:84469821-84469843 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130590582 15:85208319-85208341 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130895117 15:88164066-88164088 CTGGGTGTATGGGGTGAACAAGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131078146 15:89511779-89511801 TAATGTGTATGGTGTGAAGAAGG - Intergenic
1131568773 15:93510689-93510711 TAGTGAGAATGGGGTGGAGAAGG + Intergenic
1132773659 16:1579623-1579645 CAGTGTGTGTGGGATGCAGACGG + Intronic
1133362288 16:5183999-5184021 CAGTGGGTGTGGTGTGACAATGG + Intergenic
1133378992 16:5314191-5314213 CAGTGGGTATTGGATGGAGTTGG + Intergenic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133925441 16:10188357-10188379 AATTGGGATTGGGGTGAAGAGGG + Intergenic
1134107427 16:11494317-11494339 GAGTGGGGGTGGGGTGAAGGGGG - Intronic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1134836475 16:17365367-17365389 CAGGCGGCATGGGGTGATGAGGG + Intronic
1135787391 16:25362286-25362308 CAGAGGGGAAGAGGTGAAGAAGG + Intergenic
1138267390 16:55669568-55669590 CAGTGTGTACGGGATCAAGAAGG - Exonic
1138423682 16:56916381-56916403 CAGTGGGTTGGGGGTGACCAAGG - Intergenic
1138423873 16:56917472-56917494 CAGTGGGTTGGGGGTGACCAAGG - Intergenic
1139655864 16:68386979-68387001 CAGGGGGTGCGGGGTGAAGGTGG + Intronic
1139993738 16:70961180-70961202 CAGGGTGTATGGGGTGGGGAGGG + Intronic
1140733073 16:77873902-77873924 CTGTGGGTGGGAGGTGAAGATGG + Intronic
1140880052 16:79189914-79189936 CAGCTGGTATGGGGTGGGGAAGG + Intronic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141102894 16:81210969-81210991 CAGTAAGTATGGGGTGCAGCTGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144564309 17:16347340-16347362 CAGTGGCTATGGAGTGAGCAAGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146675153 17:34768174-34768196 CAGTGGGCAGGTGGTGAGGAAGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147019401 17:37519325-37519347 CAGAGGTTATGGGGTGGAGGGGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1148212475 17:45816851-45816873 CAGCTGGTAAGGGGTGAAGCTGG + Intronic
1148651778 17:49255284-49255306 AAGTGGGGGTGGGGTGAACACGG - Intergenic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1150550237 17:66203407-66203429 CAGTGGCCATGTGGTGCAGAGGG + Intergenic
1152563445 17:81089854-81089876 CAGTGGGTGTGAGGTGAGGGTGG + Intronic
1153617956 18:6951654-6951676 CAGGGGGTCAGGGGTGAAGCGGG + Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155185429 18:23383169-23383191 CAGGAGGTATGGGCTGGAGATGG + Intronic
1155451090 18:25963647-25963669 CAGTGGGTTTGGGGTGGGAATGG - Intergenic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157909686 18:51604149-51604171 CATTGAGTAAGGGGTGGAGAAGG + Intergenic
1158309746 18:56145178-56145200 CTGTGGATCTGGGGTCAAGATGG - Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1160238650 18:77106395-77106417 CAGTGGCTGTGGGGTGATGGGGG - Intronic
1160675009 19:385560-385582 CCTTGGGTATGGGGAGAAAAAGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162373404 19:10291812-10291834 GAGTGGGTGTGGGGAGGAGATGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163883242 19:19945345-19945367 GAGTGGGTAAGGGGTGGTGATGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164750971 19:30654414-30654436 GACTGGGGATGGGGTGAATAAGG - Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1166531356 19:43545463-43545485 CTGTTGGTCTGGGGTGAAGCCGG - Intronic
1166738563 19:45100555-45100577 CAGTGGGTAAGTGGTGGAGCTGG + Intronic
1167786616 19:51643146-51643168 GAGAGGGGATGGGGTGCAGATGG + Exonic
1167856719 19:52247899-52247921 CAGTGGTTATGGGGATAAAAGGG + Intergenic
1168233369 19:55047076-55047098 CAGCTGGTTTGGGGTGAAGCTGG + Intronic
1168243123 19:55097049-55097071 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243139 19:55097118-55097140 GCGTGGGGAAGGGGTGAAGACGG - Intronic
1168243174 19:55097283-55097305 GCGTGGGGAAGGGGTGAAGACGG - Intronic
1168243203 19:55097402-55097424 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243255 19:55097631-55097653 CTGCGGGGAAGGGGTGAAGACGG - Intronic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
926101472 2:10121077-10121099 TAGTGTGTTTGGGGTGAAAATGG + Intergenic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927982284 2:27381490-27381512 CAGTGGGTATGAGGTGTGCAGGG - Exonic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
930348515 2:50218567-50218589 CCGTGGGTATGTGGTGGGGAGGG - Intronic
930687697 2:54326728-54326750 GAGTGGTCATGGGGTGAAGATGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932416907 2:71579083-71579105 CAGGGGGTGTGGGGTGGAGAGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933758259 2:85657546-85657568 CAGAGGCTGTGGGGAGAAGATGG + Intronic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934159530 2:89235050-89235072 CATTGGGTGGGGGGTGAAGGGGG + Intergenic
934207748 2:89947381-89947403 CATTGGGTGGGGGGTGAAGGGGG - Intergenic
934556563 2:95289730-95289752 CAGTGGAGATATGGTGAAGAGGG - Exonic
934575928 2:95401652-95401674 CAGCGGGTCTGGGGAGAGGATGG - Intergenic
934886953 2:98033224-98033246 CAGTGAGTATTAGCTGAAGAGGG - Intergenic
935515090 2:104026665-104026687 CGGTGGGGATGAGGTGAACAGGG + Intergenic
935708832 2:105879754-105879776 GAGTGGGCAGGAGGTGAAGAGGG - Intronic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937510300 2:122587697-122587719 CAATGGGGATGAGGTGGAGAAGG + Intergenic
938137463 2:128770845-128770867 CAGTGGGAAAGGGGTGCAGGGGG - Intergenic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
944101603 2:196033439-196033461 CAGGGGGAATGGGGAGATGATGG - Intronic
944239815 2:197475496-197475518 CACTGGGTATAGAGTGATGAAGG + Intergenic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
946172995 2:217906310-217906332 GAGTGTGGATGGGGAGAAGAAGG - Intronic
947267351 2:228298349-228298371 CATGGGGTATGAGGTGAAGCAGG - Intergenic
947429143 2:230010377-230010399 CAGTGGGGTGGGGGTGAAGGTGG + Intronic
948261395 2:236606893-236606915 CAGTGGATCTGGGGTGAGGCTGG - Intergenic
948409249 2:237746662-237746684 CAGATGGTATGGGCTGCAGATGG + Intronic
1172442832 20:34977981-34978003 CAGTGGCACTGGGGTGAAGGAGG - Exonic
1172446839 20:34997650-34997672 GGGTGGGTATGGGGTGAGGAAGG - Intronic
1172758528 20:37305509-37305531 CAGTGGGTAGGGGGGTATGATGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173743854 20:45421423-45421445 GAGTGGCTATGGGCTGCAGAAGG + Exonic
1173810497 20:45952391-45952413 CAGTGGGTCTTGGCTGGAGATGG + Exonic
1175844183 20:62050025-62050047 CAGTAGGCGTTGGGTGAAGATGG - Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1177778670 21:25599111-25599133 CAGTAGGTAAGGGGTGCTGATGG - Intronic
1178604065 21:34019900-34019922 AAAAGGGTATGGGGTGAAGATGG + Intergenic
1178923411 21:36755553-36755575 CAGTGGGAATGACGTGAACATGG - Intronic
1179615817 21:42582530-42582552 TGGTGGCTATGGGGTGAGGAAGG - Intergenic
1179723516 21:43329317-43329339 GGGTGGGTGTGGGGTGATGAGGG + Intergenic
1179992960 21:44958201-44958223 CAGTGGCTATGGGGAGGGGAAGG - Intronic
1180124850 21:45783810-45783832 CAGTGGTGAGGGTGTGAAGATGG + Intronic
1180131672 21:45830661-45830683 CAGTGGGGAAGGGGTGGAAAGGG - Intronic
1180148511 21:45935411-45935433 CAGTGGGGTTGGGGTGGTGAAGG - Intronic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1182974490 22:34610350-34610372 CAGGGGGGATGGGGTGGGGATGG - Intergenic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183005061 22:34894517-34894539 CAGTGAGGATGGGGTCAGGAAGG + Intergenic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
1184257202 22:43294158-43294180 CAGTGGGAAAAGGGTGCAGAGGG - Intronic
1184291270 22:43499229-43499251 CAGTGGGGATGGGGTGGTGGTGG + Intronic
1184294897 22:43517028-43517050 CACAGGGTATGGGGTGACCACGG + Intergenic
1184408523 22:44313525-44313547 CAGTAGGAATGGGGTGGGGATGG + Intergenic
1184568618 22:45308725-45308747 CAGTGACTCTGGGATGAAGAGGG - Intergenic
1184970901 22:48019169-48019191 AGGTGGGTTTGGGGTGAAAAGGG + Intergenic
1185239642 22:49735677-49735699 CAGGGGCCATGGGGTCAAGACGG + Intergenic
1185302199 22:50087716-50087738 CAGTGGGCAAGTGGTGAGGAGGG + Intergenic
949376138 3:3392501-3392523 CACTGGGGATGGGGTGATGCAGG - Intergenic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950451363 3:13067523-13067545 CAGTGGGGAAGGGGTGGGGAGGG + Intronic
950916081 3:16646629-16646651 CCGTGGGGATGGGGCCAAGAGGG + Intronic
951115360 3:18854971-18854993 CACTGGGGATGGGGTGGAGGTGG - Intergenic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
953203756 3:40801582-40801604 CATTGGGTATGGGCAGAGGAAGG + Intergenic
953688671 3:45098573-45098595 GAGGGGGTGTGGGGTGAAGGAGG - Intronic
954153909 3:48674260-48674282 ACATGGGTGTGGGGTGAAGAGGG + Exonic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955507781 3:59649023-59649045 CAGTGGGTCTGGTTTCAAGATGG - Intergenic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
955982285 3:64539289-64539311 CAGTGGCTGTGGGGTGGAGAAGG + Exonic
956474714 3:69607990-69608012 CAGTGAGTATGAGGTGGGGAGGG + Intergenic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
958624560 3:96607309-96607331 CAGTGAGCATGGGCTGAAGCAGG - Intergenic
958868799 3:99532802-99532824 CAGTGGCTATGCTGTGTAGAGGG - Intergenic
959049285 3:101509138-101509160 GAGTGGGAAAGGGGTGGAGAGGG - Intronic
959254524 3:103992059-103992081 CAGTGGGGTGGGGGTGGAGATGG + Intergenic
959459296 3:106604750-106604772 CAGTGGGTTTGGTTTCAAGATGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
961094482 3:124142745-124142767 GAGTGGGTGGGGGGTGGAGATGG - Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962678032 3:137770586-137770608 CACTGGGTCTGGGTTGAGGAAGG + Intergenic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
962927867 3:140011842-140011864 CAGTGGGTGTGGGGTGAGAGTGG + Intronic
964342283 3:155720352-155720374 CAGTGTGGATGTGGTGAAAAGGG - Intronic
964693099 3:159475665-159475687 TAATGGGTTTGGGGTTAAGAGGG - Intronic
965532225 3:169782980-169783002 GAGTGGGTTTGGGTTGAACATGG + Intronic
965557073 3:170029472-170029494 CATTGTGAATGGGTTGAAGAAGG + Intergenic
965727989 3:171739788-171739810 CAGCTGGTAAGTGGTGAAGAAGG + Intronic
966508343 3:180732296-180732318 CAGTTAGTAAGTGGTGAAGATGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968911973 4:3480999-3481021 CAGAGGGTAAGGGGTGGAGGGGG + Intronic
969548123 4:7845498-7845520 CACTAGGAATGGGCTGAAGAAGG + Intronic
970192333 4:13528524-13528546 AAGTGGGTAGAGGGTGAGGAGGG + Intergenic
970221747 4:13818885-13818907 CAATGGGAATGTGGTGAAGGTGG - Intergenic
970838363 4:20437964-20437986 CATGGGGTATGAGGTAAAGAGGG - Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
973779606 4:54276213-54276235 TGGTGGGTAGGGGGTGAAAAGGG - Intronic
973889374 4:55354040-55354062 CAGGTGTTATGGGGTTAAGAAGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974723561 4:65772103-65772125 CACTGGGTGTGAGGTGAAGCAGG - Intergenic
975288149 4:72644897-72644919 CAGTGTGAATGGGGTTATGAAGG - Intergenic
975587945 4:75969825-75969847 TAGTTGGTATGGGGTGTAGCTGG - Intronic
976127508 4:81849658-81849680 CAGTGGATTTGGGCTGAAGTTGG - Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978308686 4:107361533-107361555 AAATGGGTCTGTGGTGAAGATGG + Intergenic
980449879 4:132957495-132957517 CAGTGTGACTGTGGTGAAGATGG + Intergenic
982637290 4:157913049-157913071 CACTGGGCATGGGGTGGAGGGGG + Intergenic
982810114 4:159814630-159814652 CAGTGTGTATGTGGAGAATAGGG + Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983949920 4:173627622-173627644 CAGTGGCTGTGTTGTGAAGATGG + Intergenic
983949927 4:173627673-173627695 CAGTGGGTCTGTTGTGAAGGTGG + Intergenic
985320893 4:188709661-188709683 CAGAGAGTATGGCTTGAAGAGGG + Intergenic
985320901 4:188709731-188709753 CAGAGAGTATGGCTTGAAGAGGG + Intergenic
985419401 4:189768929-189768951 CAGTGGATATTTAGTGAAGAGGG + Intergenic
985606486 5:860921-860943 GAGTGTGTATGGGGTGCAGGTGG - Intronic
986384239 5:7216206-7216228 GAGTGGGCATGGGGTGGAGGGGG + Intergenic
986557385 5:9025381-9025403 GCCTGGGTATGGGGTGAAGAGGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989637684 5:43554425-43554447 CAATTGATATGGGGTGAAAAAGG - Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
994016703 5:94975175-94975197 CAAAGGGAAAGGGGTGAAGAGGG + Intronic
994092760 5:95823445-95823467 AAATGGTTATGGGGTGAAGCCGG - Intronic
994430276 5:99650060-99650082 CAGTGGGGATGTGGTGAAAAGGG + Intergenic
994750136 5:103727091-103727113 CAGAAGGTCTGGGGTGAAGATGG + Intergenic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
995119558 5:108521174-108521196 CAGGGGTTATGGGGAGATGAGGG + Intergenic
995887784 5:116915703-116915725 AAGTGGGTGTGGGGTGCTGAAGG + Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
997641739 5:135452877-135452899 CAGTTTGGAAGGGGTGAAGATGG + Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999646496 5:153722757-153722779 CATGGGGTACGGGGTGTAGAAGG + Intronic
999676281 5:154006352-154006374 CGGTGGGTATGGGTAGAAGGTGG + Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002634394 5:180599959-180599981 GAGTGGTAATGGGGTGAGGATGG + Intergenic
1003791672 6:9553264-9553286 CAGTGGAGAGGGGATGAAGATGG + Intergenic
1005305394 6:24508752-24508774 CAGTGTGGATGTGGTGAACAGGG - Intronic
1005426428 6:25707457-25707479 CAGTGGTTGGGGGGTGAGGAGGG + Intergenic
1006171985 6:32098266-32098288 CCGTGGGTATGTGCTGGAGAAGG - Intronic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1008696861 6:54048501-54048523 CAGTGGGCATGTGGTCATGAAGG + Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1013084667 6:106846301-106846323 CAGTGGGTATTGGGTCATGGTGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1016712691 6:147191812-147191834 CAGGGGGACTGGGGTGAACATGG + Intergenic
1016940419 6:149478804-149478826 CATCAGGTATGGGGTGAAGATGG - Intronic
1017102424 6:150860345-150860367 CCTTGGGAATGGGGTGAAAAGGG + Intergenic
1018368325 6:163144955-163144977 CAGAGGGGATGGGGAAAAGAGGG - Intronic
1018844706 6:167547502-167547524 GAGGAGGGATGGGGTGAAGAGGG - Intergenic
1018844719 6:167547546-167547568 GAGGAGGGATGGGGTGAAGAAGG - Intergenic
1019550217 7:1598499-1598521 CAGTGGGTGTCGGCTGCAGAGGG + Intergenic
1021606577 7:22414737-22414759 GAGTTAGTATGGGATGAAGAGGG + Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022528791 7:31054188-31054210 AAGTGTGTGTGGGGTGACGATGG + Intronic
1023501325 7:40852767-40852789 CAGTGGGGAGGGGCTGAAGTGGG - Intronic
1024126877 7:46307723-46307745 TAGTGTGGATGGGGTGAACAGGG + Intergenic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1024908905 7:54422059-54422081 CAGTGGATTTGGGGTGGAAAAGG - Intergenic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1030067849 7:105674140-105674162 CAGTGGGTAGGAGGTGAAGAGGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031132102 7:117844355-117844377 AAGTGGAGATGGGGTGAAGCAGG + Intronic
1031876694 7:127149864-127149886 CAGTGGTTATGGGGTCAGGGTGG + Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032772667 7:135075193-135075215 GAGTGGGTATGGCTTTAAGAGGG - Intronic
1032900141 7:136297809-136297831 CAGTTGGAGTGGGTTGAAGAGGG + Intergenic
1033227451 7:139572963-139572985 CAGTGGGTATCCAGTGTAGACGG + Exonic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033583672 7:142758826-142758848 GAGGGGGTATGGGGTGGAGAGGG + Intronic
1033810874 7:145009441-145009463 CAGTATGCATGGGATGAAGATGG - Intergenic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035695816 8:1594985-1595007 CAGTGTGTATGGATTCAAGATGG - Intronic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038363031 8:26901943-26901965 CAGCATGTATGGGGTGCAGAGGG + Intergenic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041974703 8:63784166-63784188 CAGTGGGTATGAGGCAAACATGG + Intergenic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043684864 8:83072408-83072430 CAGTGGTTATGGGGTCTAGTAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044967647 8:97588451-97588473 CACTGGGCAAGGGGTGAAGGCGG + Intergenic
1045767018 8:105684459-105684481 CAGCGGGTATGGGGAAAAGGTGG + Intronic
1046521976 8:115336526-115336548 CAGTTGTAATGGGGTGAAGCTGG + Intergenic
1047413976 8:124648837-124648859 CAGTGGGCATTGGATAAAGATGG - Intronic
1048176113 8:132154242-132154264 CAGTTTGTATGGGGAGAAGGGGG - Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1050670638 9:7992761-7992783 CAGTGGGGATGGGGTAGTGAAGG + Intergenic
1050760448 9:9062986-9063008 CAGTGGGTAGGGGCTAAACATGG + Intronic
1051274022 9:15381806-15381828 CAGTGGTTAAGGGGTTAACATGG - Intergenic
1051765252 9:20515578-20515600 CGGTGAGTATGGGGAGAAAAAGG - Intronic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1052477707 9:28981684-28981706 CAGTGGATATGTGGTAGAGATGG - Intergenic
1052921404 9:33973298-33973320 TAGTGAGTATAGGATGAAGAAGG - Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1056896612 9:90556712-90556734 CAGTGGATGGTGGGTGAAGATGG - Intergenic
1057786465 9:98091873-98091895 GAGTGGGGATAGGGTGGAGACGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058103106 9:100938225-100938247 CAGTGGGTATGGGAAGTGGATGG + Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058830701 9:108813727-108813749 CAGTTGGGAAGAGGTGAAGATGG + Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059802893 9:117768591-117768613 CAATGGGGATGGGGAAAAGACGG + Intergenic
1060426825 9:123513209-123513231 GTGTGGGTGTGGGGTGAACAAGG - Intronic
1060852545 9:126889581-126889603 GAGAGGGAATGGGCTGAAGAGGG - Intergenic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1186301455 X:8204271-8204293 CCATAGGTATGGGCTGAAGACGG + Intergenic
1186401948 X:9268372-9268394 CAGTTCAGATGGGGTGAAGATGG - Intergenic
1190292422 X:49001570-49001592 CATTAGGCCTGGGGTGAAGAAGG - Intronic
1190730617 X:53223309-53223331 CAGTGGGTAGAGGGTCAGGAAGG - Intronic
1191932142 X:66385761-66385783 CAGTGAGTAAGGAGTTAAGAGGG + Intergenic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1193872243 X:86813932-86813954 TAGTGGGTATGTGGTGATGCTGG - Intronic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195407136 X:104527167-104527189 CAGTGGGTCTGGTTTAAAGATGG - Intergenic
1195824464 X:108982964-108982986 TAGTGGGTGTGGGGTGAATTGGG - Intergenic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197958168 X:131975299-131975321 CGGTGGGGATGCGGTGAAAAGGG - Intergenic
1198089883 X:133318131-133318153 GAGTGGGGAAGGGGTGAGGATGG - Intronic
1198568848 X:137934072-137934094 CATTGGGGATGTGGTGAAAAGGG - Intergenic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200110211 X:153737120-153737142 CAGCGGGGCTGGGGTGGAGAGGG - Intronic
1200752229 Y:6956976-6956998 GAGGGGCTAGGGGGTGAAGAGGG - Intronic
1200887263 Y:8281926-8281948 CAGTGGTTATGGGATCATGAAGG + Intergenic
1201355931 Y:13097110-13097132 CAATTGGTAGGGGGTGAAAATGG + Intergenic