ID: 988920634

View in Genome Browser
Species Human (GRCh38)
Location 5:35938566-35938588
Sequence GTTGCTTCGAACTGAAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988920630_988920634 3 Left 988920630 5:35938540-35938562 CCTTAAATGCTAACCTTTTGCCA 0: 1
1: 0
2: 6
3: 28
4: 196
Right 988920634 5:35938566-35938588 GTTGCTTCGAACTGAAACTATGG 0: 1
1: 0
2: 0
3: 4
4: 56
988920631_988920634 -10 Left 988920631 5:35938553-35938575 CCTTTTGCCACCAGTTGCTTCGA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 988920634 5:35938566-35938588 GTTGCTTCGAACTGAAACTATGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988920634 Original CRISPR GTTGCTTCGAACTGAAACTA TGG Intronic
902073647 1:13764767-13764789 TTTGCTTCCAACAGAAACAATGG - Intronic
907093714 1:51754327-51754349 GTTGCTACAAACTTAAACTCTGG + Intronic
909962043 1:81858424-81858446 GGTGCAAAGAACTGAAACTAAGG + Intronic
911504785 1:98735312-98735334 GTTTCTTAGAATTGAAATTATGG + Intronic
913278266 1:117160082-117160104 GTGGCTTGGATATGAAACTAAGG + Intronic
921725637 1:218520644-218520666 TTTGCTTAGAACTGATACTTTGG + Intergenic
922942467 1:229479582-229479604 GTTGCTTTGAACTGAAGAGATGG + Intronic
1064928711 10:20599347-20599369 GTTGATTCTAATTTAAACTATGG - Intergenic
1065580881 10:27170719-27170741 GATGCTTCTATCTGAATCTAAGG - Exonic
1073083782 10:100875638-100875660 GTTGCTCTGACCAGAAACTAAGG - Intergenic
1080588761 11:33703515-33703537 GTTGGTTCCAAATGAAACCAGGG - Intronic
1080589301 11:33707664-33707686 GTTGGTTCCAAATGAAACCAGGG - Intronic
1084656690 11:70523782-70523804 ACTGCTTTGAACTGAAATTATGG - Intronic
1085584221 11:77686066-77686088 GTTTCTTGGAAATGAAACTATGG - Intronic
1093930121 12:24947988-24948010 ATTTCTTCTAAGTGAAACTATGG + Intronic
1095419703 12:42012403-42012425 GTTGCTTGGAACAGACAGTAAGG - Intergenic
1101499357 12:105288097-105288119 AGTGCTTCAAACTGAGACTATGG + Intronic
1106247789 13:27963586-27963608 GTTGCTTTGAAAAGAAACTCAGG - Intronic
1108204768 13:48076942-48076964 GTGGCTTAAAACTAAAACTATGG + Exonic
1113911934 13:113846225-113846247 GATTCTTGGAACTGTAACTACGG + Intronic
1115816418 14:37168993-37169015 CTTGCGTTCAACTGAAACTAGGG - Intronic
1127458245 15:59174719-59174741 TTTTCTTGGAACTGAAAGTAGGG - Intronic
1128653859 15:69443679-69443701 ATTGCTTCAAACTATAACTATGG + Intronic
1137005453 16:35271355-35271377 GTTGCTACCATCTGTAACTATGG + Intergenic
935156209 2:100485810-100485832 CTTGCTTCAAAGTTAAACTATGG + Intergenic
939214981 2:139225113-139225135 GTAGCCACGATCTGAAACTATGG + Intergenic
946800457 2:223410131-223410153 GTAGCTTCTATTTGAAACTATGG - Intergenic
1169989871 20:11490072-11490094 GTTTCTTCAACCTTAAACTAGGG + Intergenic
1172661646 20:36573143-36573165 GTTGCTTCGAGGGGAAACTGAGG - Intergenic
950874692 3:16261066-16261088 GTTGCTCTGAACTGAAGATAGGG - Intronic
951874723 3:27409579-27409601 GCTACTTCAAACTAAAACTATGG + Intronic
951988145 3:28644170-28644192 GTTGCTTAGAATTGAATTTAAGG - Intergenic
954848421 3:53579660-53579682 GTTGCTCTGAACTGAACTTAGGG + Intronic
960801310 3:121543209-121543231 ATTGCTTGAAACTGAAACTTGGG - Intronic
963389208 3:144636174-144636196 GTTCCTTAGAACTAAAATTAGGG + Intergenic
965900990 3:173641637-173641659 GTTGCCTCAAACTGAAATTAAGG + Intronic
972185560 4:36523695-36523717 GTTGGTTGAAACTAAAACTATGG + Intergenic
974154674 4:58055748-58055770 GTTGTTGGGAACTGAAACAAAGG - Intergenic
974943512 4:68497425-68497447 GTTGTTTGGAAATGAAAATAAGG - Exonic
974999921 4:69210961-69210983 GTTTCTTCATATTGAAACTAAGG + Intronic
978501487 4:109414760-109414782 GCTGCTGCAAACTGAAACTAGGG + Intergenic
979855247 4:125624134-125624156 GTTCCATTGAACTGAAGCTATGG + Intergenic
982029170 4:151282007-151282029 GGTGCTTCCAACTTCAACTAGGG - Intronic
988411947 5:30897544-30897566 GTTGCTTAGAACTGACGTTAGGG + Intergenic
988920634 5:35938566-35938588 GTTGCTTCGAACTGAAACTATGG + Intronic
990474199 5:56145677-56145699 GTAGCATGGAACTGAATCTAGGG + Intronic
992522569 5:77570407-77570429 GTTGCTTACAAATGAAACTAGGG + Intronic
993104340 5:83581873-83581895 GTTGCTCTAAACTGAAATTAGGG - Exonic
993701030 5:91119595-91119617 TTTGCTTCTACCTGCAACTATGG - Intronic
1005206288 6:23409029-23409051 GGTGCTTCCATCTGAAACAAGGG - Intergenic
1007451448 6:41942588-41942610 GTTTCTCCAAACAGAAACTAAGG - Intronic
1009951546 6:70402615-70402637 GTTGCTTCTAACTGCAAAAAAGG + Intergenic
1012658801 6:101859928-101859950 GATTCTTCCAACTGAAAATAAGG - Intronic
1014017003 6:116543753-116543775 CTTGCTTCCAACTGAAAACATGG - Exonic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1035271060 7:157720246-157720268 GTAGCTACCAACTGAACCTAAGG - Intronic
1044334464 8:90962836-90962858 GTTGCTTCCACCTGAGACAAGGG + Intronic
1046315810 8:112500414-112500436 GTTTTCTAGAACTGAAACTATGG - Intronic
1046808415 8:118505557-118505579 GATGAGTCGAACTGAAACCATGG + Intronic
1053189959 9:36056204-36056226 GTAGCTCCAAACTGAAGCTATGG - Intronic