ID: 988922998

View in Genome Browser
Species Human (GRCh38)
Location 5:35962007-35962029
Sequence CCAGTGTTGAAATGGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988922998_988923006 6 Left 988922998 5:35962007-35962029 CCAGTCTCCCATTTCAACACTGG 0: 1
1: 0
2: 3
3: 37
4: 232
Right 988923006 5:35962036-35962058 TCCCATCCAGGGTCATTTACTGG 0: 1
1: 2
2: 2
3: 27
4: 131
988922998_988923004 -5 Left 988922998 5:35962007-35962029 CCAGTCTCCCATTTCAACACTGG 0: 1
1: 0
2: 3
3: 37
4: 232
Right 988923004 5:35962025-35962047 ACTGGGATCCATCCCATCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 115
988922998_988923003 -6 Left 988922998 5:35962007-35962029 CCAGTCTCCCATTTCAACACTGG 0: 1
1: 0
2: 3
3: 37
4: 232
Right 988923003 5:35962024-35962046 CACTGGGATCCATCCCATCCAGG 0: 1
1: 0
2: 0
3: 17
4: 131
988922998_988923010 27 Left 988922998 5:35962007-35962029 CCAGTCTCCCATTTCAACACTGG 0: 1
1: 0
2: 3
3: 37
4: 232
Right 988923010 5:35962057-35962079 GGTACTGCTTCTCTTCCAGTCGG 0: 15
1: 29
2: 19
3: 35
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988922998 Original CRISPR CCAGTGTTGAAATGGGAGAC TGG (reversed) Intronic
900188647 1:1344230-1344252 CCAGTGGAGAAATAGGAGCCCGG + Intronic
900343070 1:2197742-2197764 CCAGTGGTGACATGGGAGGAGGG - Intronic
900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG + Intergenic
900706169 1:4081801-4081823 CCACAGGGGAAATGGGAGACAGG - Intergenic
904268420 1:29331773-29331795 TGAGTGTTGAAAGGGCAGACTGG - Intergenic
904340924 1:29834010-29834032 TCAGAGTAGGAATGGGAGACTGG - Intergenic
908314970 1:62923631-62923653 CCACTGTTGAAAGGGAAGCCTGG + Intergenic
908675484 1:66598802-66598824 CCAGTGTTGGAGAGGGAGCCTGG - Intronic
909380992 1:74998291-74998313 TCAGTGTTGGAATGGGTGACTGG - Intergenic
909491942 1:76235891-76235913 CCATTGTTAAAAGGGGAAACGGG - Intronic
910460761 1:87445817-87445839 CCAGTGTTGAAGGAGGAGCCTGG - Intergenic
910629299 1:89339761-89339783 CCAATGATGAGATGGGAGACTGG + Intergenic
911453417 1:98094585-98094607 CCAGTGTTGAAATTCCAGAAGGG + Intergenic
916394838 1:164374609-164374631 CCAGTGAACAAATGGGAGAGTGG - Intergenic
916436261 1:164780618-164780640 ACAGTGCTGAGATGAGAGACAGG + Intronic
916735835 1:167606376-167606398 CCAGTGTTGAAAGTGGGGCCTGG + Intergenic
918229375 1:182514310-182514332 CCACTGACGAGATGGGAGACTGG - Intronic
918767111 1:188500373-188500395 CCAGTGTTGGAAGTGGAGCCTGG + Intergenic
921732418 1:218593221-218593243 CCAGTGTTGAAGGTGGAGCCTGG - Intergenic
921931638 1:220759446-220759468 CCAGTGCAGGGATGGGAGACAGG + Intronic
923934819 1:238748455-238748477 CCAGTGATGAAATGGGGGAATGG + Intergenic
924167784 1:241303170-241303192 CCAGTGTTGTAAAAGGAGCCTGG + Intronic
1063199896 10:3778061-3778083 TCAGTGTTAAAATGGAAAACAGG - Exonic
1063426824 10:5956816-5956838 CCAGGGTTGAAAAAGCAGACAGG + Intronic
1064317414 10:14271185-14271207 CCAGTGTTGGAGGTGGAGACTGG - Intronic
1065251533 10:23820206-23820228 ACAGTGTTGAACTAGGAGTCAGG - Intronic
1065256528 10:23875165-23875187 TCAGTGTTGAAACTGGAGCCTGG - Intronic
1065264052 10:23956902-23956924 CCAGTTTTGGAAGTGGAGACTGG - Intronic
1068658964 10:59603822-59603844 CCAGTGTTGGAAGTGGTGACTGG - Intergenic
1068806060 10:61195080-61195102 GTAGTGTTGAACTAGGAGACAGG + Intergenic
1068920172 10:62475134-62475156 CCATTGTTGAAATAGGGGAAAGG - Intronic
1070205342 10:74253404-74253426 GCAGTGTTGACATGGCACACTGG + Intronic
1070543606 10:77435437-77435459 CCTTTGTTCAAAAGGGAGACAGG + Intronic
1071346272 10:84696842-84696864 CAAGTGTTGAGATGGGTGCCAGG + Intergenic
1071711918 10:88058290-88058312 CAACTGTTTAAATGGAAGACTGG + Intergenic
1073118094 10:101103837-101103859 CCAGGGGTGGAATGGGAGGCGGG + Intronic
1073729257 10:106270468-106270490 CCAATAATGAAATGGGAGAATGG + Intergenic
1074509844 10:114101882-114101904 ACCGTGTGGAAATGGGAGAGGGG + Intergenic
1077013099 11:388186-388208 CCAGTGATAAAATGGGAGAATGG + Intergenic
1077066132 11:641614-641636 TCAGTGTTCAGATGGGAGCCTGG - Intergenic
1077986076 11:7352349-7352371 CCAGTGTAGATATTGGGGACAGG - Intronic
1081188885 11:40079452-40079474 CGAGTGTTGGAAGGGCAGACAGG - Intergenic
1081426733 11:42933833-42933855 CCAGTGTTGGAGGGGGAGCCTGG - Intergenic
1081690066 11:45071849-45071871 CCAGTGTGGAAACGAGGGACAGG - Intergenic
1082646769 11:55735699-55735721 CCAGTGTGTCAATGGGAGATTGG + Intergenic
1084784586 11:71434832-71434854 ACGGTGTTGAACTGGGACACTGG - Exonic
1085341742 11:75735944-75735966 CAACTGTTGAAAAGGGAAACAGG - Intergenic
1087461608 11:98454688-98454710 CCAGTGATGAGATGGAAGCCTGG - Intergenic
1088123185 11:106393799-106393821 CCAGTGTTGAAGGTGGAGCCTGG - Intergenic
1088620241 11:111674353-111674375 CCAGTATTGAACTTGGAGATAGG + Intronic
1090415418 11:126537024-126537046 CCAGTGGAGAAAGGGGAGGCAGG - Intronic
1090893942 11:130952504-130952526 CCAGTGATGACATGGCAGCCAGG + Intergenic
1092569832 12:9709728-9709750 CCAATGATGAGATGGAAGACTGG + Intergenic
1096518094 12:52169279-52169301 CCAGTGTTGGAAGTGGAGCCTGG - Exonic
1096828616 12:54297970-54297992 CCGGTGTTGAAATGGCATCCTGG - Intronic
1097077783 12:56408091-56408113 CCAGTAATGAAATGGGACAATGG - Intergenic
1098509200 12:71291888-71291910 CCACAGTTGAAATGGGATGCAGG + Intronic
1098513492 12:71346539-71346561 CCAAAGTTGAAATGGGTGATTGG - Intronic
1099286398 12:80717779-80717801 CGAGTGTTGACATGGAAGATGGG + Intronic
1099535589 12:83840200-83840222 TCAGTGTTAAAATGTGAGATAGG + Intergenic
1100429651 12:94519267-94519289 CCAGTGTTGAAAGTGGGGTCTGG - Intergenic
1103797302 12:123513295-123513317 CAAGTGTTCAAATGGCAGGCGGG - Intronic
1106504726 13:30361104-30361126 CAAGTGTTGAGGTGGGAGACAGG + Intergenic
1106620559 13:31367170-31367192 CCAGTGATGAAGTGGGACAATGG + Intergenic
1107230881 13:38108862-38108884 CCAGTGTTGAAAGTGGGGCCTGG - Intergenic
1107797116 13:44064350-44064372 CCAGTGCAGAAATTGGAGCCAGG + Intergenic
1108598908 13:51973820-51973842 CCACTGTTGACATGGGAGGCAGG + Intronic
1108950471 13:56086674-56086696 CCAGTGTTGGAAAAGGGGACTGG + Intergenic
1109030529 13:57182992-57183014 CCAATGATGAAATGGGAGAATGG - Intergenic
1109066896 13:57706769-57706791 CCACTGTTGAAATGGTGGATTGG + Intronic
1111275278 13:85938604-85938626 CCAATGATGAAATGGCAGAATGG + Intergenic
1112693897 13:101926289-101926311 CCAGTTTTTAAATGAGAGTCCGG + Intronic
1115268409 14:31525783-31525805 CCAGTGTTGAAAGTGGGGCCTGG - Intronic
1115936740 14:38560897-38560919 CCAGTGTTGAAAGTGGGGCCTGG - Intergenic
1120139287 14:80910335-80910357 CCAGTGTTGGAAGTGGAGCCTGG + Intronic
1120443496 14:84565764-84565786 CCAGTGATGAAATGTGAGAATGG - Intergenic
1121014607 14:90540901-90540923 CTAGTGCTGAGGTGGGAGACAGG + Exonic
1121092263 14:91190888-91190910 CAAGGGTGGAAACGGGAGACTGG + Intronic
1124832310 15:33161165-33161187 CCAGTTTAGAAATGGAATACAGG - Intronic
1131302936 15:91215368-91215390 GCAGTTTTGGAATGGGAGCCAGG + Intronic
1132712402 16:1275102-1275124 ACACTGTAGAAAAGGGAGACGGG + Intergenic
1132987234 16:2773831-2773853 CCACTGTTGAAATTAGAGAAAGG + Intronic
1134562888 16:15226021-15226043 CCAGTGTTGAAAAAGGGGCCAGG - Intergenic
1134923425 16:18137654-18137676 CCAGTGTTGAAAAAGGGGCCAGG - Intergenic
1135207346 16:20494403-20494425 CCAATGATGAAATAGGAGAGTGG + Intergenic
1135211539 16:20529229-20529251 CCAATGATGAAATAGGAGAGTGG - Intergenic
1137749144 16:50845712-50845734 CCAGTTTTCAAAGGGGAGGCTGG + Intergenic
1138218652 16:55228975-55228997 CCAGTGTTGAAGTTGCAGCCTGG + Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1141923400 16:87151673-87151695 CCAGTGTTGGAAGTGGAGCCTGG + Intronic
1141950417 16:87335821-87335843 CCAGTGTTGGCAGGGGTGACAGG + Intronic
1142981724 17:3676270-3676292 CCATTTTTGACAGGGGAGACTGG + Intronic
1143629984 17:8133531-8133553 CCACTGTTGAAAGGGCAGCCAGG - Intergenic
1144317715 17:14079005-14079027 CAAGTTTTGAAAAGGGAGACTGG - Intronic
1144533320 17:16061832-16061854 GCAGTGTTGTAACGGGAGGCTGG + Exonic
1146443373 17:32916452-32916474 CCAGCGTTGGAATGGGTGACTGG - Intergenic
1147037181 17:37690473-37690495 CAAGGGTGGAAGTGGGAGACAGG + Intronic
1148208955 17:45796637-45796659 CCACTGTTCAAACGAGAGACTGG - Intronic
1148259694 17:46170372-46170394 CAAGTGTTAAAATTGAAGACTGG + Intronic
1148839152 17:50483634-50483656 CCAGTGTAGAATTTGGAGAATGG + Intronic
1149865919 17:60150904-60150926 CCAGCGCTGAATTGGGAGCCTGG + Intronic
1152041884 17:77908969-77908991 ACAGTGTTGAAGTGGGAGCGGGG - Intergenic
1153428285 18:4989493-4989515 CCAATGATGAAATGGGAGAATGG - Intergenic
1153737868 18:8091253-8091275 GCAGTGTTGAACTTGGAAACCGG - Intronic
1155737191 18:29238680-29238702 CCAGTGTTGGAAGTGGAGCCTGG + Intergenic
1155839760 18:30630657-30630679 CCAGTGATAAAATGGGAGAATGG - Intergenic
1158062535 18:53363284-53363306 CCAGTGAAGAAATGACAGACAGG - Intronic
1158309190 18:56140406-56140428 CAAATATGGAAATGGGAGACCGG + Intergenic
1158777425 18:60601616-60601638 CCAGTTTTGAAGTAGGAGAATGG - Intergenic
1159777738 18:72623205-72623227 CCAGTGTTGAAGGAGGGGACTGG - Intronic
1160439942 18:78882027-78882049 CCAGTTTTGGAAGAGGAGACTGG + Intergenic
1164143520 19:22495011-22495033 CCAATGATGAGATGGGAGACTGG + Intronic
925977277 2:9150122-9150144 CCAGCGTGGAAATTGGAAACTGG + Intergenic
926528569 2:14012489-14012511 CCAGTGTTGAAATGGCTGGCTGG + Intergenic
929969859 2:46564781-46564803 CAAGTGTTGAAAAGGGTGAGAGG + Intronic
934978865 2:98824034-98824056 GAAGTGTTGACATGGGAGACTGG - Intronic
936492673 2:112986066-112986088 CCAGTGTTGAAGGTGGAGCCTGG + Intergenic
936561169 2:113541311-113541333 CCAGCGCTGAAATCGGAGGCCGG - Intergenic
937013806 2:118585257-118585279 ACACTGTTGAACTTGGAGACAGG - Intergenic
939816765 2:146906056-146906078 CCAGTCTTTCAATGAGAGACAGG + Intergenic
941186380 2:162325591-162325613 CCAGTGATGACATGGGAAACTGG - Intronic
942203115 2:173592297-173592319 CCAGTGTTGAAGGGGGGGCCTGG - Intergenic
943238626 2:185355985-185356007 CCAGTGTTGAAGGTGGAGACTGG + Intergenic
943903651 2:193472024-193472046 CCAGTGATAACATGGGAGAATGG + Intergenic
947892689 2:233639757-233639779 CCCATGTTGAAATTGGAGATGGG - Intronic
948104098 2:235399109-235399131 CCAGTGTTGAAAGTGGGGCCTGG + Intergenic
1169415889 20:5415923-5415945 CCAGTGTTGAATATGGGGACTGG - Intergenic
1169505896 20:6211011-6211033 CCAATGTTGAAATGAGGGCCTGG - Intergenic
1169852631 20:10069137-10069159 GTAGTGGGGAAATGGGAGACAGG + Intergenic
1170364219 20:15582148-15582170 CCAGGGTGGAGAAGGGAGACTGG + Intronic
1171329638 20:24326143-24326165 CAAGTGTTGATGTGGGAGGCAGG + Intergenic
1171800292 20:29606768-29606790 TCAGAGATGAAATGGGAGAGGGG + Intergenic
1176210464 20:63918534-63918556 CCAGTTTTTAAATTAGAGACGGG + Intronic
1177124638 21:17181345-17181367 CCAATGATGAGATGGGAGAATGG - Intergenic
1177513829 21:22122435-22122457 CCAATGATGAGATGAGAGACTGG + Intergenic
1179339547 21:40491595-40491617 ACAGAGAGGAAATGGGAGACAGG - Intronic
1179514246 21:41895577-41895599 CAAGATTTTAAATGGGAGACAGG + Intronic
1183511047 22:38235190-38235212 CCAGTGTTGGAATGAGAGTGGGG - Intronic
1184030450 22:41891323-41891345 CCAGTGTTGATACTGGATACTGG - Intronic
950364826 3:12475379-12475401 CCAGTGTAGAGATGGCATACAGG + Intergenic
951999375 3:28768256-28768278 ACAGTCTTGAAAGTGGAGACTGG - Intergenic
952003175 3:28809834-28809856 CCAGTGATGAAATGGGAGATTGG - Intergenic
953609446 3:44435249-44435271 CCAGTGAGGAGATGGGAGAATGG - Intergenic
953777090 3:45828912-45828934 CCAGGGTTGAGATGGCAAACAGG + Intronic
954314165 3:49792238-49792260 CCAGTCTTGGAATGGGAGGAGGG - Intronic
954468486 3:50672762-50672784 TCAGGGTGAAAATGGGAGACAGG + Intergenic
956399892 3:68866290-68866312 CCAGTCTTGAAATGGGAGTGTGG - Intronic
956557726 3:70541018-70541040 CCAGTGATGAATTGGGAGAATGG - Intergenic
958038754 3:88200887-88200909 CCAGTGTTGAAAGTGGGGCCTGG - Intergenic
958632701 3:96702465-96702487 CCAATGATGAAGTGGAAGACTGG + Intergenic
959391894 3:105785632-105785654 ACAGTATTGAAATGAGACACAGG - Intronic
960379945 3:116947704-116947726 CCATTGTTTAAAAGGGAGAGGGG + Intronic
960902361 3:122565209-122565231 TGAGTATTGAAATGGGAGACTGG + Intronic
961223778 3:125220718-125220740 CCAGTGGTGAAAGAGGAGAGAGG + Intergenic
963095732 3:141537313-141537335 GGACTGGTGAAATGGGAGACAGG - Intronic
963565480 3:146923919-146923941 CTAGTAATGAAATTGGAGACTGG + Intergenic
963627338 3:147690262-147690284 GTAGTGTTGAAAGGAGAGACTGG - Intergenic
964073441 3:152664116-152664138 CCAGTGTTGGAAGTGGAGCCTGG - Intergenic
965197911 3:165623570-165623592 CCAATGACGAAATGGGAGAATGG - Intergenic
965320849 3:167249880-167249902 CCAGTGACGAGATGGAAGACTGG + Intronic
965711983 3:171564658-171564680 CCAGTGCTGAAATCATAGACCGG - Intergenic
966051005 3:175617930-175617952 CCGATGATGAAATGGGAGAATGG - Intronic
967405765 3:189114723-189114745 ACAATGTAGAAATGGGATACTGG - Intronic
967865113 3:194183721-194183743 CTAGTCTTGAACTGGGAGTCAGG + Intergenic
970966502 4:21934446-21934468 CCAGTGTTGAAGGTGGAGCCTGG - Intronic
971575110 4:28263041-28263063 GCAGTGTTGGAATGGGGGCCTGG + Intergenic
971859922 4:32089563-32089585 CCAGTGATGAAATGAGAGAATGG - Intergenic
973293565 4:48491646-48491668 CCAGTGCGGAAATGGGAGAGAGG - Intronic
974250265 4:59376149-59376171 CCAGTGATGAGATGGGAGACTGG - Intergenic
976922196 4:90454580-90454602 TCAATGATGAAATGGGAGAATGG - Intronic
978322704 4:107515769-107515791 GCAGAGTGGAAATGTGAGACTGG + Intergenic
979136626 4:117118415-117118437 CCAATGATAAAATGGGAGAATGG - Intergenic
979188884 4:117833303-117833325 CCAATGATGAGATGGGAGACTGG - Intergenic
979881827 4:125970046-125970068 CCAGTGTTGAAGGAGGAGCCTGG - Intergenic
979919775 4:126481273-126481295 CCAATGATGAGATGGGAGAATGG + Intergenic
980716889 4:136638986-136639008 CCAGTGATGAGATGGAAGATTGG + Intergenic
981064339 4:140465856-140465878 ACAGTGTTGTTGTGGGAGACTGG - Intronic
981180045 4:141730959-141730981 CCAGTGGTGAAAAAGGACACAGG + Intronic
982273439 4:153615493-153615515 GCAGTGTTGAATTTGCAGACTGG + Intronic
982987605 4:162230978-162231000 CCAATGTAGGAATGGGAGCCAGG + Intergenic
983778303 4:171636386-171636408 CCAGTGTTGAAAGAGCAGAATGG + Intergenic
984512995 4:180701653-180701675 CCAGTGATGAAGTGGGCAACTGG - Intergenic
987552096 5:19396361-19396383 CCAGTGTTGGAGGTGGAGACTGG + Intergenic
987717615 5:21592663-21592685 CCAGTGTTGGAAGTGGAGACTGG + Intergenic
988604331 5:32667048-32667070 CCAGTGATGGAATGGGAGAATGG - Intergenic
988922998 5:35962007-35962029 CCAGTGTTGAAATGGGAGACTGG - Intronic
989542089 5:42629317-42629339 CCAATGTTGGAAGTGGAGACTGG + Intronic
990720045 5:58684561-58684583 CCAGTGTGGATATGGGGGTCAGG - Intronic
992791010 5:80213677-80213699 CCAGAGTTTGCATGGGAGACAGG - Intronic
994244946 5:97468186-97468208 CCAATGATGAAATGGGAGAATGG - Intergenic
994774592 5:104026472-104026494 CCAATGATGAGATGGGAGAATGG + Intergenic
996031593 5:118711637-118711659 CCAGTGTTGAGTTGGGAGAAGGG - Intergenic
997354144 5:133251639-133251661 TCAGCCTGGAAATGGGAGACCGG - Intronic
999363610 5:151006792-151006814 CCAGGGTGGAAATGGGAGCAGGG - Intergenic
999446309 5:151642749-151642771 CCAGTGTTGAAAGAGGGGCCTGG - Intergenic
999736849 5:154519284-154519306 CCAGTGTGGCAAGGGGAGAGGGG - Intergenic
999737688 5:154524916-154524938 CCAGTGTGGCAAGGGGAGAGGGG - Intergenic
1000295298 5:159908377-159908399 CCAGTGTTGAAAGTGGGGCCTGG + Intergenic
1001302084 5:170540913-170540935 CCAGTGCAGAAATGGCACACTGG - Intronic
1001367397 5:171157011-171157033 ACAGTGCTGTAATGTGAGACAGG - Intronic
1001939460 5:175730167-175730189 CCAGGGTGGAAATGGTAGAGCGG - Intergenic
1001998033 5:176177686-176177708 CGTGTGTTGAAGAGGGAGACCGG - Intergenic
1002415074 5:179116121-179116143 CCAGGGTGGAGGTGGGAGACGGG - Intronic
1003118908 6:3304209-3304231 CCAGTGGTGCAAGGGCAGACAGG + Intronic
1003167901 6:3697393-3697415 CCTGTGTGGCAATGGGAGACAGG - Intergenic
1003738438 6:8905678-8905700 CCAGTGTAGAATTGGCAGAGTGG + Intergenic
1004312693 6:14559594-14559616 GCATTGTTGAGATGGGAGAGGGG + Intergenic
1004887654 6:20067134-20067156 GCAGTGTTAAAAGTGGAGACTGG - Intergenic
1005216289 6:23532258-23532280 CCAGTGACCAAATGGTAGACTGG + Intergenic
1007679711 6:43625716-43625738 ACAGTGTGGACATGAGAGACAGG + Intronic
1009242820 6:61201284-61201306 CCAGTGGTGAAATGGGAGAATGG - Intergenic
1010161334 6:72860092-72860114 CCAGTGAAGAGATGAGAGACAGG + Intronic
1010839478 6:80631467-80631489 CCAGTGTTGAAATAACAGACAGG - Intergenic
1011157979 6:84355139-84355161 CCAGTGTTGAAAGTGGGGCCTGG + Intergenic
1011435695 6:87334182-87334204 CCAGTGTTGAAGGTGGAGCCTGG - Intronic
1011650282 6:89499816-89499838 ACAGAGTTGAAAGGGAAGACAGG - Intronic
1011826532 6:91312588-91312610 TCAGTGTTGAAATGGCAGTCCGG + Intergenic
1013480604 6:110549726-110549748 CCAGAGTTGAAATAGCAGAAGGG + Intergenic
1014277031 6:119399117-119399139 CCAATGATGAGATGGGAGAATGG - Intergenic
1014467398 6:121773134-121773156 CCAATGTTGAAAGGTGAGAGGGG + Intergenic
1017628655 6:156374252-156374274 CCAGAGTTGAAATAGAAGATTGG + Intergenic
1019816433 7:3204489-3204511 CCAGTGTTGGAAGAGGAGCCTGG - Intergenic
1021169451 7:17381069-17381091 CTAGTGTTGAAATGGGGGTGGGG - Intergenic
1021370388 7:19837933-19837955 GGACTGTTGAAATAGGAGACAGG - Intergenic
1022283615 7:28934502-28934524 CATGTGTAGAAAGGGGAGACAGG + Intergenic
1024300865 7:47886489-47886511 CCAGTGTTGGAGGGGGAGCCTGG + Intronic
1029483317 7:100825409-100825431 ACAGTGTGTAAATTGGAGACAGG - Intronic
1030386940 7:108876704-108876726 CCAATGATGAGATGGGAAACTGG + Intergenic
1031262622 7:119541014-119541036 CCAGAGCTGAAATAGTAGACAGG - Intergenic
1031463752 7:122082969-122082991 CCAGTGTGCAAATGGGAAGCAGG + Intronic
1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG + Intergenic
1032503413 7:132417231-132417253 CCAGAGATGAAATGGCAGAAAGG + Intronic
1035062159 7:156077373-156077395 CCAGTTTTGGAAGGGGAGCCTGG - Intergenic
1035143786 7:156792057-156792079 CCAGTGTTTAAATGGTAGTTAGG - Intronic
1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG + Intergenic
1039427467 8:37497643-37497665 CCAGAGTTGAAAGAGGAGCCTGG - Intergenic
1039445239 8:37625897-37625919 CCAGTGTTGGTGTGGGAGCCAGG - Intergenic
1039453777 8:37695440-37695462 CCAGTGGTGAGAAGGGAGAGAGG + Intergenic
1039659932 8:39450362-39450384 CCAATGGTGAGATGAGAGACTGG + Intergenic
1041541930 8:58994756-58994778 CCTGTGTGGGAATGGGAGTCAGG - Intronic
1044008434 8:86964297-86964319 CCAATGATGAAACGGGAGAATGG - Intronic
1044250471 8:89999809-89999831 CCAGTGTTGGAATTGGGGCCTGG - Intronic
1046631405 8:116626144-116626166 CCACTGTTGTATTTGGAGACAGG + Intergenic
1049891516 9:74003-74025 CCAGCGCTGAAATCGGAGGCCGG + Intergenic
1051110276 9:13627539-13627561 CCAGTGCAGAAATGGGACACTGG - Intergenic
1051512075 9:17889274-17889296 CCAGTGTTGAAGGTGGAGCCTGG - Intergenic
1052326012 9:27217382-27217404 CGAGGCTTGAAAGGGGAGACAGG - Intronic
1053076886 9:35141059-35141081 CCAATGATGAAATGGGAGAATGG + Intergenic
1053732947 9:41075092-41075114 CCAGCGCTGAAATCGGAGGCTGG + Intergenic
1054695479 9:68356451-68356473 CCAGCGCTGAAATCGGAGGCTGG - Intronic
1055401931 9:75933142-75933164 GCAGCTTTGAAATGGGAGATGGG + Intronic
1055914636 9:81388630-81388652 CCACTGATGAAATGAGAGACTGG - Intergenic
1057185635 9:93056126-93056148 TCAGTGTTCAAATAGGTGACAGG + Intergenic
1057438225 9:95062199-95062221 CCAGTGTTGAATTAGGTGGCTGG + Intronic
1058828511 9:108795519-108795541 CCAATGATGAGATGGGAGAATGG + Intergenic
1058831503 9:108821801-108821823 GCAGTGTTGCAATGGGAGGCAGG + Intergenic
1059622553 9:116023615-116023637 CCAGTGTTGGAAGAGGGGACTGG + Intergenic
1059848040 9:118303374-118303396 TCAGTGTTAAAATGGGAGGCTGG - Intergenic
1060453990 9:123772790-123772812 CCAGTGGTGACATGGTGGACTGG - Intronic
1061729537 9:132603024-132603046 CCAGTGTAGAACTCGGAGCCCGG - Intronic
1186662973 X:11687772-11687794 CTAGAGTTGAAATGGGAGTCGGG - Intergenic
1188237165 X:27744641-27744663 CCAGTGTTGAAAGTGGGGCCAGG + Intronic
1192315791 X:70050303-70050325 CCAGGGCTCAAATGGGACACAGG + Intergenic
1193162869 X:78247382-78247404 CCATTGTAGAAATGGTAGAAAGG + Intergenic
1193530232 X:82647132-82647154 TCAGTGTGGAAAGGCGAGACAGG + Intergenic
1193638317 X:83980614-83980636 CCAGTGTTGAAGTTGGGGCCTGG + Intergenic
1194124041 X:89992004-89992026 CCAGTGATGAAATGGAAAAATGG - Intergenic
1194397330 X:93402276-93402298 CCAGTGTTGAAGAGGGGGCCTGG + Intergenic
1195721989 X:107876554-107876576 CCAATATTGAGATGGGAGAGTGG - Intronic
1196034495 X:111129537-111129559 CCCGTGTTGAAATGGGAAGAAGG + Intronic
1196297931 X:114020435-114020457 TCAGTATTGAAAGGGGAGAGTGG - Intergenic
1197863554 X:130995442-130995464 CCAGGGTGGACATGGGAGAGAGG - Intergenic
1200476929 Y:3649626-3649648 CCAGTGATGAAATGGAAAAATGG - Intergenic