ID: 988927033

View in Genome Browser
Species Human (GRCh38)
Location 5:36000154-36000176
Sequence TGGGGTGTAAGCAGCACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988927033_988927036 -8 Left 988927033 5:36000154-36000176 CCCCTAGTGCTGCTTACACCCCA No data
Right 988927036 5:36000169-36000191 ACACCCCAATCCACCACTTTCGG No data
988927033_988927042 28 Left 988927033 5:36000154-36000176 CCCCTAGTGCTGCTTACACCCCA No data
Right 988927042 5:36000205-36000227 TCCCCTTATGAAATTAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988927033 Original CRISPR TGGGGTGTAAGCAGCACTAG GGG (reversed) Intergenic
No off target data available for this crispr