ID: 988930874

View in Genome Browser
Species Human (GRCh38)
Location 5:36034584-36034606
Sequence CTTCTCATCCACATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988930867_988930874 8 Left 988930867 5:36034553-36034575 CCTTGGAAACACAGCTACAATTG No data
Right 988930874 5:36034584-36034606 CTTCTCATCCACATGGAGCTGGG No data
988930866_988930874 13 Left 988930866 5:36034548-36034570 CCTGTCCTTGGAAACACAGCTAC No data
Right 988930874 5:36034584-36034606 CTTCTCATCCACATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988930874 Original CRISPR CTTCTCATCCACATGGAGCT GGG Intergenic
No off target data available for this crispr