ID: 988932167

View in Genome Browser
Species Human (GRCh38)
Location 5:36047290-36047312
Sequence GCACCCATGACAGCTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 4, 2: 10, 3: 23, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988932167_988932172 12 Left 988932167 5:36047290-36047312 CCTCCTGAAGCTGTCATGGGTGC 0: 1
1: 4
2: 10
3: 23
4: 143
Right 988932172 5:36047325-36047347 GGCAAATAAAGTTTCTAAATTGG 0: 1
1: 2
2: 6
3: 58
4: 282
988932167_988932169 -9 Left 988932167 5:36047290-36047312 CCTCCTGAAGCTGTCATGGGTGC 0: 1
1: 4
2: 10
3: 23
4: 143
Right 988932169 5:36047304-36047326 CATGGGTGCATCCTCAACCTTGG 0: 9
1: 49
2: 106
3: 235
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988932167 Original CRISPR GCACCCATGACAGCTTCAGG AGG (reversed) Intronic
900519082 1:3097008-3097030 GCACCCATGGCTGCAGCAGGTGG - Intronic
900725401 1:4213298-4213320 CAAACCAGGACAGCTTCAGGGGG - Intergenic
901455130 1:9358763-9358785 GAGCTCATGACAGCATCAGGGGG - Intronic
903024090 1:20414737-20414759 GAACCCATGTCAGCCTGAGGAGG + Intergenic
905929433 1:41776920-41776942 GCTCCCATGACAGCTCTGGGAGG + Intronic
906248720 1:44295037-44295059 GCTCCCCTGACACCTTCAAGAGG + Intronic
908020160 1:59890674-59890696 GCACCCAGGAGAGGTCCAGGAGG - Intergenic
910951546 1:92653579-92653601 GCACCCATGCCAGTTTCCTGTGG - Intronic
911295746 1:96112546-96112568 GAACTCATGACAGCTTCAGCTGG + Intergenic
912979807 1:114361246-114361268 GCATCCATGACAGCCTCAGGAGG - Intergenic
913942774 1:125123452-125123474 GAACCCACAACAGCTCCAGGAGG + Intergenic
915601580 1:156925782-156925804 GCATCCATGCCATCTACAGGAGG - Intronic
918720057 1:187841274-187841296 GCACATATGACAGCCTCAGGAGG + Intergenic
919920344 1:202163419-202163441 GCACCCACCACAGCCTCAGATGG - Intergenic
921045234 1:211472112-211472134 CCACCCATGAGACCTTCAGTTGG + Intergenic
1067119049 10:43458188-43458210 GCGCCCATGACAGCCTCAGGAGG + Intronic
1067830152 10:49607130-49607152 GCACCCTGGACAGCTCCCGGCGG + Intergenic
1069143955 10:64865397-64865419 GCGCCCATGACAGCCCCAGGAGG + Intergenic
1072611715 10:97021435-97021457 GCAGGCATTACAGCTTCATGGGG + Intronic
1073353794 10:102837742-102837764 GGACAGATGACAGATTCAGGAGG + Intergenic
1073879171 10:107959801-107959823 GTACCCATGACGGCATGAGGTGG - Intergenic
1074363058 10:112838212-112838234 GCTCCCAAGACAGCCCCAGGTGG + Intergenic
1074463091 10:113656450-113656472 ACACCCACGACAGCCTCAGGAGG - Intronic
1075411330 10:122230467-122230489 GCACACATGACATTCTCAGGAGG - Intronic
1075412169 10:122236404-122236426 GCAGCCATGACAGCGCCACGAGG + Intronic
1075592425 10:123702636-123702658 ACACCCATGAAATCTTGAGGCGG - Intergenic
1076434553 10:130431139-130431161 GCAGCGATGTCAGCTGCAGGTGG - Intergenic
1077558483 11:3240156-3240178 ATACGCATGACAGCCTCAGGAGG + Intergenic
1077809457 11:5622843-5622865 GCACCCATGACAGCCTCAGGAGG + Intronic
1082736831 11:56865408-56865430 GCACCTGTGACATCCTCAGGAGG - Intergenic
1084614916 11:70229364-70229386 GTGCCCGTGACAGCCTCAGGAGG - Intergenic
1086493062 11:87375221-87375243 GGACCCATGACAGCCTTAGGAGG + Intergenic
1086974263 11:93114652-93114674 GGTCCCTAGACAGCTTCAGGTGG - Intergenic
1088876587 11:113941535-113941557 GCCAGCAGGACAGCTTCAGGCGG + Intronic
1090334761 11:125954921-125954943 GTCCCCATGTCAGCTGCAGGGGG + Intergenic
1090354857 11:126133478-126133500 TCACCCATGCCAGCCTCTGGAGG + Intergenic
1099024451 12:77447958-77447980 GCACAGCTCACAGCTTCAGGAGG + Intergenic
1102586165 12:113924431-113924453 CCACCCCTGACAGTTTGAGGTGG + Intronic
1102752996 12:115312301-115312323 CATCCCATGAAAGCTTCAGGAGG + Intergenic
1104694114 12:130850548-130850570 GCACCCATGACAGCCTCAGGAGG - Intergenic
1106476941 13:30107261-30107283 GCAGGCATCGCAGCTTCAGGGGG - Intergenic
1106813291 13:33380801-33380823 GTACCCGTGCCAGGTTCAGGTGG + Intergenic
1108316842 13:49244744-49244766 GCGCCTGTGACAGCCTCAGGAGG - Intergenic
1111648973 13:91066027-91066049 GCACCCATGACAGCCTCAGGAGG - Intergenic
1113619344 13:111702378-111702400 GCCTCCATGACAGCATGAGGAGG + Intergenic
1113624873 13:111787639-111787661 GCCTCCATGACAGCATGAGGAGG + Intergenic
1114346444 14:21800342-21800364 TTACTCATGACAGCATCAGGAGG - Intergenic
1115491926 14:33966110-33966132 ACGCCCGTGACAGCCTCAGGAGG + Intronic
1116937789 14:50759861-50759883 GCACCAAAGGGAGCTTCAGGAGG - Exonic
1119640120 14:76308601-76308623 GCCCCCAGGCCAGCTTCAAGGGG + Intergenic
1121833349 14:97070737-97070759 GCTCCCAAGTAAGCTTCAGGAGG - Intergenic
1126114081 15:45193255-45193277 GCACACATGACAGCCTCAGGAGG + Intronic
1127312672 15:57766628-57766650 GCAGCCTTGACTGATTCAGGAGG - Intronic
1129973707 15:79803447-79803469 GCACTCATGGCAGCCTCAGTTGG - Intergenic
1132954567 16:2584838-2584860 GCATACATGAAAGCTGCAGGTGG - Intronic
1135066321 16:19313255-19313277 TCACCCATGACAGCAATAGGGGG + Intronic
1137083731 16:36097532-36097554 GAACCCACAACAGCTCCAGGAGG - Intergenic
1141161989 16:81635339-81635361 GCACACAGGACAGAGTCAGGGGG + Intronic
1142212300 16:88814090-88814112 GCACCTGTGACAGCCTCAGGAGG - Exonic
1144668775 17:17119579-17119601 GTACTGATGACAGCTTCAGGAGG - Intronic
1145774283 17:27516775-27516797 TGACCCATGACAGCTTCAGGAGG + Intronic
1148221484 17:45865425-45865447 GCACCCATGACAGCCTCAGGAGG + Intergenic
1148237653 17:45980061-45980083 GCCCCCATGCCCTCTTCAGGAGG - Intronic
1149696592 17:58621155-58621177 TCTCCCATCACAGCTGCAGGAGG - Intronic
1149865373 17:60148568-60148590 GCGACCATGACAGCCACAGGAGG - Intergenic
1151510111 17:74553189-74553211 ACATCCATGACAGCCTCAGGAGG + Intergenic
1157504498 18:48217096-48217118 GTTCCCCTCACAGCTTCAGGAGG + Intronic
1158184853 18:54760113-54760135 GCCCCCACGGCAGCTTCTGGGGG - Intronic
1159789791 18:72764509-72764531 GGACCTGTGACAGCCTCAGGGGG - Intronic
1159918238 18:74204580-74204602 ACACCTGTGACAGCCTCAGGAGG - Intergenic
1159918468 18:74205974-74205996 GCACCTGTGACAGCCCCAGGAGG - Intergenic
1160608584 18:80071091-80071113 GCTGCCATGCCAGCCTCAGGTGG + Intronic
1163443075 19:17331322-17331344 GCACCCATGACTTCATGAGGCGG + Exonic
1163685423 19:18709430-18709452 GGAGCCAGGACAGCTTCAGAGGG + Intronic
1168278287 19:55289170-55289192 CCTCCCATGTCAGCTTCAGAGGG - Intronic
1202670355 1_KI270709v1_random:44327-44349 GAACCCACAACAGCTCCAGGAGG + Intergenic
925000730 2:400996-401018 GCACCCCAGCCAGCCTCAGGGGG + Intergenic
926814031 2:16782613-16782635 CTACACATGCCAGCTTCAGGTGG + Intergenic
927384584 2:22518338-22518360 GCACCCATGACTTCCTCATGTGG + Intergenic
927938220 2:27087101-27087123 GCACCCCTGGCCGCTGCAGGTGG + Exonic
928488676 2:31758345-31758367 GAATGCATGACAGCTTCTGGGGG - Intergenic
928528475 2:32165858-32165880 GCACCCAGAACGGCTTCCGGCGG + Exonic
929295982 2:40247241-40247263 GCACCCATGACAGCTCTCTGGGG - Intronic
930473168 2:51846308-51846330 CACCCCATGACAGTTTCAGGTGG + Intergenic
930676346 2:54204798-54204820 GCATACAGGACAGATTCAGGAGG - Intronic
932688854 2:73895313-73895335 GCACCCACGACAGATTGTGGAGG + Intronic
932703704 2:74007563-74007585 GCAGCCCTTACTGCTTCAGGGGG + Intronic
946179823 2:217942606-217942628 CCACCCCAGGCAGCTTCAGGAGG + Intronic
947702393 2:232245251-232245273 GCACCCAGGTCAGCTACATGAGG - Intronic
948243137 2:236455338-236455360 GTTCCCATGACAGCTTCCTGGGG + Intronic
1169729408 20:8770505-8770527 GCGCCTGTGACAGCCTCAGGAGG + Intronic
1170458051 20:16551841-16551863 CCTCCCACGACAGCTACAGGAGG + Intronic
1170666588 20:18391966-18391988 GTAGGCATGTCAGCTTCAGGAGG + Intronic
1172702252 20:36860947-36860969 GCACCCATGACTGTTTAAAGGGG - Intronic
1173094374 20:40010868-40010890 GCCACCCTGAGAGCTTCAGGAGG - Intergenic
1174334888 20:49852901-49852923 GCACCCGTGACAGCCTCAGGAGG + Intronic
1174983691 20:55425141-55425163 GCACTCATGACAGCTGTATGTGG - Intergenic
1176046040 20:63093093-63093115 GCACCCATGACAGCTTCTGTGGG - Intergenic
1176545405 21:8195237-8195259 ATACCCGTGACAGCCTCAGGAGG - Intergenic
1176564356 21:8378282-8378304 ATACCCGTGACAGCCTCAGGAGG - Intergenic
1178436319 21:32561910-32561932 GCACCTGTGACAGCCTCAGGAGG - Intergenic
1179649476 21:42797861-42797883 GCACCTGTGACAGACTCAGGAGG - Intergenic
1179668278 21:42927487-42927509 GCGCCTGTGACAGCCTCAGGAGG + Intergenic
1179983984 21:44911012-44911034 GCACCCAGGACAGCTGCAGCGGG + Intronic
1181359697 22:22324887-22324909 TCTCCCATGACAGCATCATGTGG + Intergenic
1181369773 22:22406626-22406648 TCTCCCATGACAGCATCATGGGG + Intergenic
1182731566 22:32499882-32499904 GGACCCAACAAAGCTTCAGGAGG - Intergenic
1183343509 22:37294745-37294767 GCAACCATGGCAGTTTCTGGGGG - Intronic
1184917924 22:47585766-47585788 ACACCCATTACAGCCTCAGGAGG - Intergenic
1203250275 22_KI270733v1_random:111475-111497 ATACCCGTGACAGCCTCAGGAGG - Intergenic
950045608 3:9947102-9947124 GCGCCCATGTCAGCTCCAGGAGG + Exonic
953019525 3:39104749-39104771 GAAGCCATGGCAGCTTCTGGAGG - Intronic
953387389 3:42514241-42514263 TCTCCCATGCCAGCTCCAGGGGG - Intronic
954466294 3:50657002-50657024 GCAGCCCTCCCAGCTTCAGGTGG - Intergenic
955553681 3:60112295-60112317 GGCTCCAAGACAGCTTCAGGAGG - Intronic
956706988 3:72007642-72007664 ACGCCCATGACAGCCTCAGGAGG - Intergenic
960969183 3:123126972-123126994 TCACCAGTGACAGCTTCAAGTGG - Intronic
965393063 3:168128770-168128792 GAACCCATGGCAGCTCAAGGAGG + Intergenic
969703045 4:8778127-8778149 GCCCCCATCACAGCTGCTGGGGG - Intergenic
972714042 4:41628074-41628096 GGACACATTATAGCTTCAGGAGG + Intronic
973253311 4:48083483-48083505 ATGCCCATGACAGCCTCAGGAGG - Intronic
978331211 4:107614301-107614323 GGAGCCATGAAACCTTCAGGTGG + Exonic
982133141 4:152247979-152248001 GCACCCCGGACACATTCAGGGGG - Intergenic
982786583 4:159543828-159543850 GACCCCATGACAGCATCTGGGGG + Intergenic
983095556 4:163557391-163557413 GAACCAAAGAAAGCTTCAGGGGG + Intronic
985750200 5:1669235-1669257 GCAGCTGTGACAGCCTCAGGAGG - Intergenic
985975465 5:3416365-3416387 ACACCGATGGCAGCTCCAGGAGG + Intergenic
987130154 5:14852810-14852832 GAACCCAGGACAGCTTGAGTGGG - Intronic
988932167 5:36047290-36047312 GCACCCATGACAGCTTCAGGAGG - Intronic
990599518 5:57343484-57343506 ACAACAATGACAGCTTCAGAGGG - Intergenic
992293000 5:75299544-75299566 GCACCCATGACAGTCTGAGGAGG - Intergenic
994124261 5:96152030-96152052 GCTCACATGACAGTCTCAGGAGG + Intergenic
996142105 5:119924026-119924048 GCACACATGACAGCAGCAGGAGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998940305 5:147274607-147274629 GCTACCATGGCAGCTTAAGGTGG + Intronic
1004262330 6:14118648-14118670 GCAGCCTTGAGAGCATCAGGTGG + Intronic
1007076717 6:39073025-39073047 GCATCCAGGACCGCCTCAGGAGG + Intronic
1007249183 6:40484075-40484097 GTACCCATGCCAGCTCCAGAGGG + Intronic
1009996565 6:70901726-70901748 TCTCCCATGACAGCATCAGCTGG - Intronic
1013612255 6:111806366-111806388 GCACCCCTGACTGGGTCAGGAGG + Intronic
1014647687 6:123994638-123994660 TCACCCAAGTCAGCTCCAGGTGG + Intronic
1015289180 6:131519481-131519503 ACACACATGACAGCTTGAGGGGG - Intergenic
1016378673 6:143450621-143450643 GCACCCAAGCCAGCTGCAAGCGG - Exonic
1017180349 6:151546225-151546247 GCACCCATGAGAGCATCAGGTGG - Intronic
1018133192 6:160752060-160752082 GCACCCAAAACACATTCAGGAGG - Intronic
1018713778 6:166516102-166516124 GCACCTGTGACAGCCTCAGGAGG - Intronic
1018975592 6:168562856-168562878 TCACGGATGACAGTTTCAGGAGG + Intronic
1019382405 7:730868-730890 GAACCCACGCCAGCTCCAGGAGG - Intronic
1022458815 7:30584873-30584895 GTATCCAAGACAGCTTCAGGAGG - Intergenic
1022679239 7:32528335-32528357 GCACCCATGACAACCTCAGGAGG - Intronic
1023860146 7:44213589-44213611 GCACCCATGGAAGCTTCTGCTGG + Exonic
1024292618 7:47815907-47815929 GCAGCCATGGAAGCTTCAGTAGG + Intronic
1025112809 7:56233915-56233937 GCATCTGTGACAGCCTCAGGAGG - Intergenic
1025320872 7:58091960-58091982 GAACCCACAACAGCTCCAGGAGG + Intergenic
1025479178 7:60960983-60961005 GAACCCACAACAGCTCCAGGAGG + Intergenic
1025552872 7:62271831-62271853 GAACCCACAACAGCTCCAGGAGG - Intergenic
1027405256 7:77854143-77854165 GCAGCCATGTCTGCATCAGGGGG + Intronic
1031227972 7:119065463-119065485 GCACCCAGGACAAGTTCATGGGG + Intergenic
1032405541 7:131652941-131652963 GCATCCATAGCACCTTCAGGTGG - Intergenic
1033450053 7:141454486-141454508 AGACCCAGGCCAGCTTCAGGAGG + Intronic
1035339577 7:158151614-158151636 GGACAGATGAGAGCTTCAGGAGG + Intronic
1035959909 8:4125512-4125534 GCGCCCCTGACAGTCTCAGGAGG - Intronic
1038942240 8:32317867-32317889 GCACCCTCTACTGCTTCAGGGGG - Intronic
1042198132 8:66251941-66251963 TGACCCATGACAGCCTCAGGAGG + Intergenic
1043447448 8:80332849-80332871 CCACCAATGGCAGCTCCAGGGGG - Intergenic
1045083183 8:98650853-98650875 GCACCCACCACAGCTCAAGGAGG + Intronic
1048298655 8:133235275-133235297 GCGCCTGTGACAGCCTCAGGAGG - Intergenic
1048494506 8:134923922-134923944 GCACTCATGACAGCCTCAGGAGG - Intergenic
1050330205 9:4538149-4538171 TCACCTGTGACAGCCTCAGGAGG + Intronic
1053804802 9:41790472-41790494 GCATCCATGACAGCCTCAGGAGG - Intergenic
1060643834 9:125261677-125261699 ACACCCACGACAGCCTCAGGGGG + Intergenic
1061495840 9:130973744-130973766 GCACCCATGACAGCTGGGGCAGG - Intergenic
1061860267 9:133464360-133464382 GCGCCCAGCCCAGCTTCAGGGGG + Intronic
1061882755 9:133576251-133576273 GCGTCCATCACAGCTTTAGGGGG + Intergenic
1187139255 X:16576797-16576819 GTGCCCATGACAGCCTCAGGAGG - Intergenic
1189283245 X:39833917-39833939 GCCCCCATGACACCTTCGGCAGG + Intergenic
1192962608 X:76146031-76146053 GCGCCCATGACAGCCTGAGGAGG + Intergenic
1192962923 X:76149056-76149078 CCGCCCATGACAGCCTCAGGAGG - Intergenic
1194292530 X:92092417-92092439 ACGCCCATGACAGCCCCAGGAGG + Intronic
1195463400 X:105153539-105153561 TGGCCCATGACAGCCTCAGGAGG + Intronic
1200610043 Y:5316996-5317018 ACGCCCATAACAGCCTCAGGAGG + Intronic