ID: 988933822

View in Genome Browser
Species Human (GRCh38)
Location 5:36063229-36063251
Sequence TCAATATGAAAGTGTTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988933822 Original CRISPR TCAATATGAAAGTGTTGCTC AGG (reversed) Intronic
902672234 1:17982855-17982877 TCAATAGGAAAGTTTGTCTCTGG + Intergenic
907675246 1:56511935-56511957 TCAATATGCAAGTGGAGCCCTGG - Intronic
909809450 1:79913314-79913336 TTAATATGTTAGGGTTGCTCAGG - Intergenic
909988475 1:82191955-82191977 TAATTATGAAAGAGTTGGTCTGG + Intergenic
912079606 1:105918709-105918731 TAAATATAAAAGTGTTGTCCCGG - Intergenic
916213813 1:162379294-162379316 TCAAAGTGAAAGTGGGGCTCTGG - Intronic
917507960 1:175646232-175646254 TCACTCTGAAAATGTTACTCAGG + Intronic
918594139 1:186273573-186273595 TATATATGATAGTGTGGCTCAGG - Intergenic
921971500 1:221154008-221154030 TCAATAAGAAAATGTTGCACAGG + Intergenic
924032107 1:239896091-239896113 TGAAGATGAAAGTGTCCCTCCGG + Intronic
1063066453 10:2614822-2614844 TCCATAGGAGAGTGTTGTTCTGG + Intergenic
1063728470 10:8667648-8667670 TCACTATCAAAGTGTGGCTAGGG - Intergenic
1066220147 10:33329642-33329664 TCAATTCTAAAGTGTTTCTCAGG - Intronic
1068029492 10:51689562-51689584 ACAATGTGTAAGTGGTGCTCAGG + Intronic
1068268263 10:54682940-54682962 TTAATATGGAAGTGTTGCTCAGG + Intronic
1068829852 10:61481069-61481091 TCAAGATGAAAGAGATGCTCAGG + Intergenic
1071179962 10:82971735-82971757 TCACTATGAAAGGCTTTCTCAGG - Intronic
1071369602 10:84937931-84937953 TTAATAAGAAAGTTTTGGTCTGG - Intergenic
1073915584 10:108399452-108399474 TCATGAAGAAAGTGGTGCTCAGG - Intergenic
1076111014 10:127859701-127859723 TCCATATGAAAGTGTGGAACAGG - Intergenic
1086076823 11:82863728-82863750 TCTAGATGGAAGTGTTTCTCTGG - Intronic
1088583684 11:111339005-111339027 TCAAGGTGATAGTGTTGTTCAGG - Intergenic
1088607690 11:111547197-111547219 TCAATTTGAAAGGGATGTTCTGG + Intronic
1089009060 11:115118213-115118235 TCTATTTGAAAGTGTTTCTGAGG - Intergenic
1089186703 11:116621427-116621449 TCAATATCTAAGTGTAGGTCTGG - Intergenic
1089247964 11:117136439-117136461 ACAGTAAGAAAGTGTTGCTGGGG + Intergenic
1089258750 11:117208122-117208144 ACAGTAAGAAAGTGTTGCTGGGG - Intronic
1090102243 11:123811527-123811549 TCAATAAGAAATTATTTCTCTGG + Intergenic
1094408247 12:30142004-30142026 TCCATATGAGAGTGTTGATATGG - Intergenic
1097392221 12:59029143-59029165 TTAAAAAGAAAGTGTTGTTCTGG - Intergenic
1097614537 12:61868068-61868090 TCAATATGAAAATGTTGATTTGG - Intronic
1097640382 12:62173994-62174016 TCAATAAGAAAATGTTGGCCAGG + Intronic
1098651170 12:72971665-72971687 TAAAAATGAACTTGTTGCTCAGG + Intergenic
1103158054 12:118704254-118704276 TCAATATGTCAGTGTTGCATAGG + Intergenic
1103303101 12:119943119-119943141 GCAGTGTCAAAGTGTTGCTCTGG + Intergenic
1104818144 12:131660410-131660432 CAAAAATGAATGTGTTGCTCGGG + Intergenic
1106996781 13:35493425-35493447 TCCATATGAAAGTGTTTTTTAGG + Intronic
1108086202 13:46796353-46796375 TCAATTTGATAGGGTTGCTCTGG + Intronic
1110235243 13:73211061-73211083 TCATTATGAAGGTGTTGGACTGG - Intergenic
1114375041 14:22136304-22136326 TCAATATAATAGTGTTGAGCAGG - Intergenic
1115147964 14:30248390-30248412 TCAATATCAAAGGTTTTCTCTGG + Intergenic
1116398601 14:44476945-44476967 TCTATATGAAAGGGTTAATCAGG - Intergenic
1117633146 14:57714326-57714348 TGAATAATAAAATGTTGCTCAGG - Intronic
1121940682 14:98067683-98067705 TCCATTAGACAGTGTTGCTCGGG - Intergenic
1122575371 14:102738560-102738582 TCTATAGGAAGGTGTTGCACTGG - Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1123926867 15:25122468-25122490 TGAATATGAATGTGTTACACAGG - Intergenic
1125037714 15:35145443-35145465 ACAATATGAAAGTACTGCTTGGG + Intergenic
1125568941 15:40699609-40699631 TAAGTATGAAAGTGCTGTTCTGG + Intronic
1129021239 15:72521076-72521098 TCAAGGTGAAAGGGTTGCTTGGG - Intronic
1131364303 15:91825182-91825204 TGAAAATGGAAGTGTTACTCTGG - Intergenic
1133596751 16:7301229-7301251 TCAATGGAAAAGTGTTCCTCTGG + Intronic
1135303971 16:21353294-21353316 TAAGTATGAAATTGCTGCTCTGG + Intergenic
1136300704 16:29332431-29332453 TAAGTATGAAATTGCTGCTCTGG + Intergenic
1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG + Intronic
1138085076 16:54126152-54126174 TGAAATTGAAAGTGTTGCTAAGG - Intergenic
1139237119 16:65351547-65351569 CCAAGATCAGAGTGTTGCTCTGG - Intergenic
1139736894 16:68997949-68997971 TCAATGAGAAAGTGTTGGTATGG + Intronic
1146715948 17:35087569-35087591 TCAATATGAAAGTTTTTAACAGG + Intronic
1146851071 17:36221998-36222020 TCAATATGACACTATTCCTCGGG + Intronic
1151256589 17:72881906-72881928 TAAATATGAAGGTGTTGGCCAGG + Intronic
1152554768 17:81047296-81047318 ACAAGATGAAAGTGAGGCTCAGG - Intronic
1155692632 18:28644754-28644776 TAAATATGAACCTGTTTCTCTGG - Intergenic
1156615288 18:38776046-38776068 TCAAGTTGAAAATGTTTCTCTGG - Intergenic
1157722191 18:49933718-49933740 TCAATATGTCAGTGCTGCTGAGG + Intronic
1159684148 18:71395521-71395543 TCAAAATTAAAGTGTTGAGCAGG - Intergenic
1165667593 19:37646904-37646926 TCAATATAAAAGTCATGGTCAGG - Intronic
1167407968 19:49326452-49326474 TCATTCTCAAAGTGTGGCTCAGG - Intergenic
925686041 2:6474844-6474866 TCTATATCCAAGTCTTGCTCAGG + Intergenic
927402099 2:22723126-22723148 TATATATGTGAGTGTTGCTCAGG - Intergenic
928406545 2:31019414-31019436 TCAAAATGACAGTGTGGCTGGGG - Intronic
930042932 2:47142658-47142680 TGATTATGAAAGTATTTCTCAGG + Intronic
931390249 2:61836009-61836031 GCTATTTGAAAGAGTTGCTCAGG - Exonic
939202072 2:139049283-139049305 TCAATATACAAGTGTTGATACGG + Intergenic
941438103 2:165496991-165497013 TCCAGATGAAAGTGATGTTCTGG + Intronic
947032931 2:225818726-225818748 TCAGATTGAAGGTGTTGCTCAGG - Intergenic
947419312 2:229927462-229927484 TCAAAATGGAAGTGTTGCTTAGG + Intronic
947782207 2:232778401-232778423 ACAATTTGAAAGTCTTGCTATGG + Intronic
1175446182 20:59021426-59021448 TCTAAATGACAGTGCTGCTCTGG - Intronic
1176940457 21:14917774-14917796 TCAAAAAGACAATGTTGCTCTGG + Intergenic
1177187440 21:17813302-17813324 TCAATATGAAATTCTTGATTTGG - Intronic
1177220074 21:18181229-18181251 ACATTGTGAAAGTGTTGCACTGG + Intronic
1182164263 22:28156687-28156709 GAAATGTGAAAGTGATGCTCAGG + Intronic
952449078 3:33413841-33413863 TCACTATGAGAGCTTTGCTCTGG - Intronic
953638304 3:44681786-44681808 TCCATATTAAAGATTTGCTCTGG + Intergenic
954846553 3:53563605-53563627 GCAAAATTAAAGTGTTGCTGAGG - Intronic
956508585 3:69970173-69970195 TCAATATTGAAATGTTTCTCAGG + Intergenic
958135378 3:89482808-89482830 GTTATATGAAAGTGATGCTCAGG + Intergenic
959226642 3:103596319-103596341 TCCATATGACACTGTTCCTCGGG - Intergenic
959349673 3:105246223-105246245 TCATTATGAAAGTGTATCTCTGG - Intergenic
959919653 3:111856974-111856996 TCAATGTCACCGTGTTGCTCAGG - Intronic
960298226 3:115969419-115969441 TCAATATGAAGGTTATGATCAGG - Intronic
960370528 3:116831899-116831921 TCAATAGGAAAGTGATAGTCTGG + Intronic
960961285 3:123072145-123072167 TAAGGATGAAAGTGTTGTTCTGG - Intronic
962618754 3:137155376-137155398 TAAATACGAAAGTGCTGCCCTGG - Intergenic
962766793 3:138572077-138572099 TCATTATGAAAGTGATACTTAGG - Intronic
963193830 3:142504268-142504290 AAAATATGAAAATGTTTCTCAGG + Intronic
964091389 3:152880064-152880086 TCTATTGGAAAGTGTTGTTCTGG - Intergenic
967490426 3:190084575-190084597 TGAATCTGAAATTGTTACTCTGG + Intronic
970261815 4:14232574-14232596 TCATTTTGAAAGTGCTGATCAGG - Intergenic
970841203 4:20471741-20471763 ACAATATGAAATTGATGCTGTGG + Intronic
972106731 4:35497090-35497112 ACAGTATGAAAGTGTTGCTTTGG - Intergenic
974621039 4:64355342-64355364 TCAACATGAAGATGTTGCTATGG + Intronic
975417721 4:74125028-74125050 AAAAAATGAAAGTATTGCTCTGG - Intronic
977195841 4:94058030-94058052 TATATATGAAAATGTTGCTTTGG - Intergenic
979099264 4:116594931-116594953 TCAACATGAAAATGTTACTATGG + Intergenic
980576690 4:134691872-134691894 TCCATTTGAAAGTCTTGCTAGGG - Intergenic
980672046 4:136022358-136022380 TCAATAAGAAAGTTTTGCTAGGG - Intergenic
982547739 4:156756416-156756438 ACAAAATGAAAGTGTTGTTGAGG - Intergenic
982567715 4:157007347-157007369 TCAGTATGAAAGTATAGTTCTGG - Intergenic
983234966 4:165169127-165169149 TTAATAGGAAATTGTTGCTCAGG - Intronic
988933822 5:36063229-36063251 TCAATATGAAAGTGTTGCTCAGG - Intronic
991976049 5:72184544-72184566 ACCATATGAAACTGTTGCTATGG + Intronic
993180566 5:84547225-84547247 TCAAAATGAAATCGTTGCTAAGG + Intergenic
993501403 5:88671835-88671857 GCAAAATGAAAGTATTGCCCTGG + Intergenic
994264285 5:97696440-97696462 TCAATATGAAATTTTTTCACTGG + Intergenic
995318937 5:110809073-110809095 TTAATATGAAAATATTTCTCAGG + Intergenic
996491405 5:124102148-124102170 TACATATGCAAGTGTTTCTCTGG + Intergenic
998979824 5:147690001-147690023 TCACTATGACAGTGTTGCACAGG - Intronic
1000305751 5:159993130-159993152 TCAAGTTGAAAGTCTTGCTTTGG + Intergenic
1001913799 5:175542657-175542679 TCAAAATCAAATTCTTGCTCTGG - Intergenic
1005201992 6:23357786-23357808 TAAATCTAAAAGTGTTGCTTGGG - Intergenic
1008693016 6:54002127-54002149 TCACTGTAAAAGTTTTGCTCTGG - Intronic
1012250470 6:96974815-96974837 TGAATGTGAAAGAGTTTCTCAGG - Intronic
1014148166 6:118022209-118022231 TCAAAATGAAATTGGTGATCGGG + Intronic
1014230485 6:118896849-118896871 TAAATGAGACAGTGTTGCTCTGG + Intronic
1016771934 6:147861598-147861620 TCAATTTGAACCTGATGCTCAGG + Intergenic
1017684672 6:156899748-156899770 ACAATATGGAAGTGTTGTTTGGG - Intronic
1019401623 7:857348-857370 TCAATCCTAAAGTGTTGATCTGG + Intronic
1019833805 7:3360405-3360427 TCATTATGCAAATGTAGCTCTGG + Intronic
1024337038 7:48219607-48219629 TCACTATGAAAGTTTAGCACAGG - Intronic
1032149442 7:129415520-129415542 TCAAGATGAAACTGGTGCACAGG + Intronic
1032168762 7:129566731-129566753 TTAATCTGAAATTGTTCCTCGGG + Intergenic
1032189500 7:129755982-129756004 TGACTATTAAAATGTTGCTCTGG + Exonic
1036616835 8:10394542-10394564 TCAATCTGACAGAGCTGCTCAGG - Intronic
1039261238 8:35774229-35774251 AAAAAATGAAAGTGTTGGTCAGG + Intronic
1041824069 8:62072174-62072196 TAAATAGGAAATTGTTGCTTAGG - Intergenic
1042467644 8:69146490-69146512 TCAATCTGTAAGTTTTGTTCAGG + Intergenic
1043665754 8:82810523-82810545 TCAAGATCAAAGTGTTGGCCGGG - Intergenic
1045169461 8:99647822-99647844 TCATTATTAAAGTATGGCTCTGG + Intronic
1046233369 8:111387590-111387612 AGAAGATGAAACTGTTGCTCAGG - Intergenic
1047120502 8:121898674-121898696 GAGATATGAAAGTGTTGCTAAGG - Intergenic
1047871553 8:129088326-129088348 TCCAAATGAAAGTGTAGCTCAGG - Intergenic
1051326344 9:15974587-15974609 ACAATATGTAAGTGTGACTCAGG - Intronic
1051679788 9:19595495-19595517 ACAATTTGACAGTTTTGCTCAGG + Intronic
1053009852 9:34626928-34626950 TCACTATGAAGGTGTTACACAGG - Intronic
1053318794 9:37077077-37077099 TCAACTTGAAAGTGTTGGCCAGG + Intergenic
1053579173 9:39385944-39385966 TCAAAATTAAAGTGTTCGTCTGG - Intergenic
1053843688 9:42214031-42214053 TCAAAATTAAAGTGTTCGTCTGG - Intergenic
1054100757 9:60944749-60944771 TCAAAATTAAAGTGTTCGTCTGG - Intergenic
1054122130 9:61220123-61220145 TCAAAATTAAAGTGTTCGTCTGG - Intergenic
1054585591 9:66962136-66962158 TCAAAATTAAAGTGTTCATCTGG + Intergenic
1054859802 9:69938267-69938289 TCCATATCAAAGATTTGCTCTGG + Intergenic
1056305229 9:85283938-85283960 TCAAGATGGAAATGTTCCTCTGG - Intergenic
1058387615 9:104457174-104457196 TCATCATGAAAGAGATGCTCAGG - Intergenic
1059230587 9:112717937-112717959 GCAATAGAAAAGTGTGGCTCCGG - Intronic
1060020784 9:120129218-120129240 TCAAGATCAAAGTGTTGGTAGGG + Intergenic
1060025808 9:120170259-120170281 TGAACATGTAAGTGTTGGTCAGG - Intergenic
1185703719 X:2250813-2250835 TCAAGATGGCAGAGTTGCTCTGG + Intronic
1186951227 X:14627688-14627710 TCCATACGAAAGAGTTGTTCAGG - Intronic
1187058115 X:15760047-15760069 TCATTAAGAAAGTGTTGGCCGGG - Intronic
1189726961 X:43976868-43976890 TTACTATGTAGGTGTTGCTCAGG - Intergenic
1191113446 X:56827129-56827151 TCTATATTAAAGTCTTTCTCTGG - Intergenic
1194777527 X:97983076-97983098 TCAGTACGTAAGTGGTGCTCTGG - Intergenic
1195399994 X:104451216-104451238 TCAATATGCAGGTGAGGCTCTGG - Intergenic
1198273233 X:135075333-135075355 GCCATCTGAAAGTGTTTCTCAGG - Intergenic
1199714979 X:150501275-150501297 TCAATATGCAAATATTACTCAGG - Intronic
1200932906 Y:8713101-8713123 TCAATACCAAAGTGTTGATAAGG - Intergenic