ID: 988935588

View in Genome Browser
Species Human (GRCh38)
Location 5:36079407-36079429
Sequence TTCTGCCATCCTCATCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988935588_988935593 11 Left 988935588 5:36079407-36079429 CCTCCCTGATGAGGATGGCAGAA No data
Right 988935593 5:36079441-36079463 TGGAGTATGCTGAAGTCTCACGG No data
988935588_988935594 12 Left 988935588 5:36079407-36079429 CCTCCCTGATGAGGATGGCAGAA No data
Right 988935594 5:36079442-36079464 GGAGTATGCTGAAGTCTCACGGG No data
988935588_988935595 16 Left 988935588 5:36079407-36079429 CCTCCCTGATGAGGATGGCAGAA No data
Right 988935595 5:36079446-36079468 TATGCTGAAGTCTCACGGGAAGG No data
988935588_988935596 19 Left 988935588 5:36079407-36079429 CCTCCCTGATGAGGATGGCAGAA No data
Right 988935596 5:36079449-36079471 GCTGAAGTCTCACGGGAAGGTGG No data
988935588_988935591 -9 Left 988935588 5:36079407-36079429 CCTCCCTGATGAGGATGGCAGAA No data
Right 988935591 5:36079421-36079443 ATGGCAGAAAGAGATCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988935588 Original CRISPR TTCTGCCATCCTCATCAGGG AGG (reversed) Intergenic
No off target data available for this crispr