ID: 988936276

View in Genome Browser
Species Human (GRCh38)
Location 5:36086091-36086113
Sequence TACCCTCCTGAATATGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936268_988936276 14 Left 988936268 5:36086054-36086076 CCCAAACTATAAAAACCCTGGAA 0: 389
1: 1164
2: 1768
3: 1403
4: 1352
Right 988936276 5:36086091-36086113 TACCCTCCTGAATATGGGAATGG No data
988936272_988936276 -2 Left 988936272 5:36086070-36086092 CCTGGAAGACAACCTAGGCAATA 0: 458
1: 1027
2: 9797
3: 11676
4: 4465
Right 988936276 5:36086091-36086113 TACCCTCCTGAATATGGGAATGG No data
988936271_988936276 -1 Left 988936271 5:36086069-36086091 CCCTGGAAGACAACCTAGGCAAT 0: 428
1: 941
2: 9298
3: 10964
4: 3555
Right 988936276 5:36086091-36086113 TACCCTCCTGAATATGGGAATGG No data
988936269_988936276 13 Left 988936269 5:36086055-36086077 CCAAACTATAAAAACCCTGGAAG 0: 60
1: 210
2: 360
3: 328
4: 408
Right 988936276 5:36086091-36086113 TACCCTCCTGAATATGGGAATGG No data
988936267_988936276 15 Left 988936267 5:36086053-36086075 CCCCAAACTATAAAAACCCTGGA 0: 64
1: 695
2: 2356
3: 15844
4: 8142
Right 988936276 5:36086091-36086113 TACCCTCCTGAATATGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936276 Original CRISPR TACCCTCCTGAATATGGGAA TGG Intergenic
No off target data available for this crispr