ID: 988936540

View in Genome Browser
Species Human (GRCh38)
Location 5:36089011-36089033
Sequence ACTTCGGTGGTGGTTTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936540_988936545 10 Left 988936540 5:36089011-36089033 CCCTGTAAAACCACCACCGAAGT No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936540 Original CRISPR ACTTCGGTGGTGGTTTTACA GGG (reversed) Intergenic