ID: 988936541

View in Genome Browser
Species Human (GRCh38)
Location 5:36089012-36089034
Sequence GACTTCGGTGGTGGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936541_988936545 9 Left 988936541 5:36089012-36089034 CCTGTAAAACCACCACCGAAGTC No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936541 Original CRISPR GACTTCGGTGGTGGTTTTAC AGG (reversed) Intergenic
No off target data available for this crispr