ID: 988936544

View in Genome Browser
Species Human (GRCh38)
Location 5:36089027-36089049
Sequence TACGTTCTATTTTTTGACTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936544_988936548 30 Left 988936544 5:36089027-36089049 CCGAAGTCAAAAAATAGAACGTA No data
Right 988936548 5:36089080-36089102 CATTGCAATCACTAATCCCTTGG No data
988936544_988936545 -6 Left 988936544 5:36089027-36089049 CCGAAGTCAAAAAATAGAACGTA No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936544 Original CRISPR TACGTTCTATTTTTTGACTT CGG (reversed) Intergenic