ID: 988936545

View in Genome Browser
Species Human (GRCh38)
Location 5:36089044-36089066
Sequence AACGTAGCCAGCAATCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936542_988936545 0 Left 988936542 5:36089021-36089043 CCACCACCGAAGTCAAAAAATAG No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data
988936543_988936545 -3 Left 988936543 5:36089024-36089046 CCACCGAAGTCAAAAAATAGAAC No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data
988936541_988936545 9 Left 988936541 5:36089012-36089034 CCTGTAAAACCACCACCGAAGTC No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data
988936544_988936545 -6 Left 988936544 5:36089027-36089049 CCGAAGTCAAAAAATAGAACGTA No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data
988936540_988936545 10 Left 988936540 5:36089011-36089033 CCCTGTAAAACCACCACCGAAGT No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data
988936539_988936545 11 Left 988936539 5:36089010-36089032 CCCCTGTAAAACCACCACCGAAG No data
Right 988936545 5:36089044-36089066 AACGTAGCCAGCAATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936545 Original CRISPR AACGTAGCCAGCAATCCAGA AGG Intergenic