ID: 988936791

View in Genome Browser
Species Human (GRCh38)
Location 5:36091550-36091572
Sequence TCCCCAATGCTGGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936786_988936791 4 Left 988936786 5:36091523-36091545 CCACTCAAATCTTATATTGAAAT No data
Right 988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG No data
988936784_988936791 6 Left 988936784 5:36091521-36091543 CCCCACTCAAATCTTATATTGAA 0: 2
1: 55
2: 1434
3: 11161
4: 13113
Right 988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG No data
988936783_988936791 30 Left 988936783 5:36091497-36091519 CCTTGACATAGGTTAGATACTTG No data
Right 988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG No data
988936785_988936791 5 Left 988936785 5:36091522-36091544 CCCACTCAAATCTTATATTGAAA No data
Right 988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936791 Original CRISPR TCCCCAATGCTGGAGGTGGG AGG Intergenic
No off target data available for this crispr