ID: 988936861

View in Genome Browser
Species Human (GRCh38)
Location 5:36092588-36092610
Sequence GAGCATTGCCAGGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988936861_988936864 -7 Left 988936861 5:36092588-36092610 CCAGCAGCAGCCTGGCAATGCTC No data
Right 988936864 5:36092604-36092626 AATGCTCCCTCCTCAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988936861 Original CRISPR GAGCATTGCCAGGCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr