ID: 988942990

View in Genome Browser
Species Human (GRCh38)
Location 5:36164606-36164628
Sequence AAGGGCGTGCTGCTATTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988942982_988942990 26 Left 988942982 5:36164557-36164579 CCACATACTTAGAACTCCCTGTG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 43
988942980_988942990 30 Left 988942980 5:36164553-36164575 CCCTCCACATACTTAGAACTCCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 43
988942985_988942990 9 Left 988942985 5:36164574-36164596 CCTGTGTGAGATAGCAGGAGCCT 0: 1
1: 0
2: 0
3: 32
4: 833
Right 988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 43
988942984_988942990 10 Left 988942984 5:36164573-36164595 CCCTGTGTGAGATAGCAGGAGCC 0: 1
1: 0
2: 0
3: 15
4: 119
Right 988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 43
988942981_988942990 29 Left 988942981 5:36164554-36164576 CCTCCACATACTTAGAACTCCCT 0: 1
1: 0
2: 0
3: 5
4: 162
Right 988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988942990 Original CRISPR AAGGGCGTGCTGCTATTTAC AGG Intronic
909884054 1:80918259-80918281 AATGGCATTCTTCTATTTACTGG - Intergenic
911704083 1:100990557-100990579 AAGTGCCTGCTGCAATTTTCTGG + Exonic
912542971 1:110430927-110430949 ATGGGTGTGCTGCGATTTCCTGG - Intergenic
915543087 1:156581295-156581317 AAGGGGGTCCTGCTATCTAGAGG + Intronic
916689951 1:167180545-167180567 AATGGCGTGCTGCTGCTGACGGG - Intergenic
924748962 1:246867667-246867689 AAAGGTGTGGTGCTATTTATAGG + Exonic
1074058173 10:109941601-109941623 AAGGCCTTGCTGCCATTTCCTGG + Exonic
1076857254 10:133123502-133123524 ACGGGCGTGCTGCTGCTCACAGG - Intronic
1085053023 11:73389379-73389401 AAGGGCTTGCTGGCATTTATGGG + Intronic
1090352983 11:126119438-126119460 GAGCGCCTGCTGCTATTTGCAGG - Intergenic
1097392830 12:59036556-59036578 ATGGGTGTGGTGCTGTTTACTGG + Intergenic
1099578866 12:84415842-84415864 ATAGGCTTGCTGCTGTTTACCGG + Intergenic
1121054464 14:90841417-90841439 AAGGATGGGCTGCTATTTGCTGG + Intergenic
1125259334 15:37804544-37804566 AAGGGCTTGCTCCTCTGTACCGG - Intergenic
1129277149 15:74453505-74453527 AAGAGAGAGCTGATATTTACTGG + Intronic
1132082837 15:98882236-98882258 AAGTGAGTGCTGCTTTGTACAGG - Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1137288065 16:47032727-47032749 ATGGGCGTGCTTTTATTCACTGG - Intergenic
1149963329 17:61136485-61136507 GGGGGCGTGCTGCTATCTAACGG - Intronic
1153097492 18:1424567-1424589 AAGTACATGTTGCTATTTACTGG + Intergenic
1153279166 18:3398148-3398170 AAGGTCTTGCTGCTATTGTCAGG + Intergenic
1155330002 18:24705369-24705391 CAGGGCCTGTTGCTATTTACAGG - Intergenic
1161009200 19:1952066-1952088 AAGGCCGTGTTCCTGTTTACTGG + Intronic
941093242 2:161203838-161203860 AAGCTTTTGCTGCTATTTACTGG - Intronic
941118794 2:161504447-161504469 AAAGGTGTGGTGCTATTTATAGG + Intronic
941294513 2:163719517-163719539 TAGTGCTTGTTGCTATTTACTGG + Intronic
1170596465 20:17809720-17809742 AATGGCTTGGTGCTATTCACAGG + Intergenic
1175874753 20:62224113-62224135 AAGGTGGGGCTGCTATTTCCAGG + Intergenic
1184840725 22:47050988-47051010 AAGGGAGCGCTGCTATTCCCAGG - Intronic
952723115 3:36554242-36554264 AAGAGCATGCTGGGATTTACTGG + Intergenic
955088641 3:55727920-55727942 AAGGGCGTGGTGCCATTTTGTGG + Intronic
959790184 3:110350974-110350996 AAGGCCATGCAGCTATTGACTGG + Intergenic
963015885 3:140823507-140823529 AAGGGCCTGCTGTTTTTTATGGG - Intergenic
966655957 3:182359068-182359090 AAGGAGGTGGTGCAATTTACTGG - Intergenic
969745292 4:9066084-9066106 CAGGGTGTGATGCCATTTACAGG + Intergenic
985806599 5:2048876-2048898 AAGGGCGTTCTTTTATTTCCCGG - Intergenic
988942990 5:36164606-36164628 AAGGGCGTGCTGCTATTTACAGG + Intronic
995101183 5:108308061-108308083 AAGGTCGTGTTTCTATTTATAGG - Intronic
996792665 5:127309424-127309446 AATGGGGAGCTGCTATTTAATGG - Intronic
999472536 5:151868281-151868303 AAGTTCCTGCTGCTAGTTACTGG + Intronic
1010337403 6:74703037-74703059 AAAGGACTGCTGCTATATACTGG + Intergenic
1035475572 7:159141844-159141866 AAGGCCTTGCTACTATTTATAGG + Intronic
1057700204 9:97358603-97358625 AAGGGTGTGCTGTCATTCACTGG - Intronic
1060934544 9:127507582-127507604 AAGGCCGTGATGCTATCTCCAGG + Intronic
1187144664 X:16626430-16626452 AAGGGGGAGTTGCTATTTAATGG + Intronic