ID: 988943125

View in Genome Browser
Species Human (GRCh38)
Location 5:36166570-36166592
Sequence GCAACCGACCAGTCACATCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988943125_988943132 22 Left 988943125 5:36166570-36166592 CCCGGATGTGACTGGTCGGTTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 988943132 5:36166615-36166637 CCGCTGCCCACGATCATTTATGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988943125 Original CRISPR GCAACCGACCAGTCACATCC GGG (reversed) Exonic
902265104 1:15257637-15257659 GGAACTGACCAGTGACATCAGGG - Intronic
912836593 1:113001775-113001797 GCCACCCACCAGTCACATCATGG + Intergenic
913058064 1:115180128-115180150 GGAGCCGACCAGTCACCACCAGG - Intergenic
913236004 1:116784096-116784118 GCTCCCAACCAGTCACACCCAGG - Intergenic
917400037 1:174637642-174637664 GCAACCGAAAAGTCACCTTCTGG - Intronic
919373591 1:196763491-196763513 GCCACCCACCAGTCAAGTCCAGG + Intergenic
919380031 1:196848168-196848190 GCCACCCACCAGTCAAGTCCAGG + Intronic
920250786 1:204621016-204621038 GCAGCAGACCTGACACATCCAGG + Exonic
921630061 1:217422612-217422634 TCAAGAGACCAGTCACATCAAGG + Intergenic
1064553293 10:16523122-16523144 GCAAGCAAACAGTAACATCCTGG + Intergenic
1071973625 10:90932981-90933003 TCAACCGTCCAGTGTCATCCTGG - Intergenic
1073201449 10:101739117-101739139 ACAACCGACCATTTGCATCCGGG + Intergenic
1076891114 10:133283899-133283921 GGAACCGACCTGGCACATCCTGG - Exonic
1098786590 12:74765904-74765926 TCAACCAACCAGTGTCATCCAGG + Intergenic
1103317345 12:120066957-120066979 GCAACAGGCCTGTCACAACCAGG + Intronic
1104954280 12:132456902-132456924 GCCCCAGACCAGTCTCATCCCGG + Intergenic
1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG + Intergenic
1107429309 13:40325760-40325782 GAAACCCACCAGTCCCCTCCTGG + Intergenic
1107708853 13:43133058-43133080 GCAACCAACTAGTCACACACAGG - Intergenic
1121724974 14:96140572-96140594 CCAACCCACCACTCACAACCTGG + Intergenic
1122074166 14:99224975-99224997 GGAGCCCACCAGACACATCCTGG - Intronic
1133292458 16:4731695-4731717 GCGTGCCACCAGTCACATCCTGG - Intronic
1143972831 17:10807924-10807946 ACAAAGGCCCAGTCACATCCTGG + Intergenic
1150613152 17:66749477-66749499 GCAAACCTCCAGTCCCATCCAGG + Intronic
1151341196 17:73472038-73472060 GGCACCCACCAGCCACATCCTGG - Intronic
1158111664 18:53946798-53946820 GCAATCAATCAGCCACATCCTGG + Intergenic
1162456210 19:10786563-10786585 GCAACTGACCAACCACATCCGGG + Exonic
1163586953 19:18169368-18169390 GGACCAGACCAGCCACATCCAGG + Exonic
1164632614 19:29771536-29771558 TCAACCCACAAGTCTCATCCCGG - Intergenic
1167710151 19:51105432-51105454 CCAACCCTCCAGTCAAATCCTGG + Intronic
1168575181 19:57503345-57503367 GAAACCCACCACTCCCATCCAGG - Intronic
939014161 2:136882192-136882214 GCAACCTAACAGTCACTTGCTGG + Exonic
945181602 2:207097318-207097340 GTAACTGACCAGTCACTTTCAGG - Intronic
1169395639 20:5226539-5226561 GCAACAGTCCAGACACAGCCAGG - Intergenic
953420931 3:42752589-42752611 GCAGCTGACCAATCGCATCCAGG - Exonic
953626968 3:44579552-44579574 GCAACCAGCTGGTCACATCCGGG + Intronic
968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG + Exonic
978531542 4:109719990-109720012 TCAACCTACCAGTCACCTACTGG + Intronic
982312841 4:154003792-154003814 GCACCCGACCAGCCCAATCCAGG + Intergenic
984186172 4:176546279-176546301 CCAACCAACCAGTGGCATCCTGG - Intergenic
984281226 4:177673084-177673106 GCAAGGGACCATTCACCTCCCGG + Intergenic
987184914 5:15407479-15407501 GCAACCAGACAGTCCCATCCGGG + Intergenic
988943125 5:36166570-36166592 GCAACCGACCAGTCACATCCGGG - Exonic
993888180 5:93441493-93441515 GCAACCGACTAATGACCTCCAGG - Intergenic
998869844 5:146541247-146541269 GCAGCCTTCCAGTCACATGCAGG + Intergenic
1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG + Intergenic
1013266815 6:108508185-108508207 GCAACTGAGGAGTCAGATCCAGG + Intronic
1018697157 6:166399357-166399379 GCAATCGACACGTCTCATCCAGG - Intergenic
1018724781 6:166603513-166603535 GCTACCGACCAGTCACCTTCTGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019706856 7:2500825-2500847 GCCACAGGCCAGCCACATCCTGG - Intergenic
1026289602 7:68994491-68994513 GCTACCTACCAGTCATATCCAGG + Intergenic
1028485878 7:91356672-91356694 GCAACTGAACAGTTAAATCCAGG - Intergenic
1029542652 7:101193299-101193321 GCATCCAACCAGTCACAATCCGG - Intergenic
1029940091 7:104470898-104470920 GCAACCTACATATCACATCCAGG + Intronic
1031628981 7:124022936-124022958 GCAACTGTCCAGTCCAATCCAGG + Intergenic
1035561132 8:604308-604330 GCAACCCAGCACTCACACCCCGG - Intergenic
1052319374 9:27151020-27151042 GTCACAGCCCAGTCACATCCAGG + Intronic
1061055768 9:128222196-128222218 GCAACTGACGAACCACATCCGGG + Exonic
1062206013 9:135337781-135337803 GCAACCTACTAGGCACGTCCCGG - Intergenic
1185785047 X:2883799-2883821 GCAACTGGACAGTCCCATCCAGG + Intergenic
1197916820 X:131544488-131544510 GCAACCAAGCAGACACATACTGG - Exonic