ID: 988945646

View in Genome Browser
Species Human (GRCh38)
Location 5:36195141-36195163
Sequence CTGTGCTTCTTGAACAGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988945646 Original CRISPR CTGTGCTTCTTGAACAGTGA AGG (reversed) Exonic
902295288 1:15462954-15462976 CTCTGCTTCTTCTACAGGGAGGG + Intronic
902573424 1:17361391-17361413 CTGGGGACCTTGAACAGTGAAGG - Intronic
902638457 1:17750732-17750754 CTGTGCTTCCTGGACTGTTAGGG - Intergenic
904015951 1:27420830-27420852 CTGAGCTTCTTGCAAGGTGAAGG + Intronic
904295433 1:29517137-29517159 ATGTTCATCTTCAACAGTGAGGG - Intergenic
905306515 1:37022806-37022828 CAGTGCTTCTAGCACAGTGCAGG - Intronic
905654495 1:39677298-39677320 CAGTGCTTCTTGGACTGTCAGGG + Intergenic
906651891 1:47518677-47518699 CTGTGGTACTAGAACACTGAAGG + Intergenic
906746665 1:48226627-48226649 CTGTGCCCCATGAACAGTGTGGG + Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
908164855 1:61448028-61448050 CTGTGCTTTGTGTACAGTGGGGG + Intronic
909596759 1:77414357-77414379 CAGGGCTTCTTAAGCAGTGAAGG - Intronic
909905916 1:81194482-81194504 CTGGGTTTCTTGAATAGTGGGGG - Intergenic
911865453 1:103014538-103014560 CTGAGCTTCCTGAGCAGAGATGG + Exonic
914675397 1:149904110-149904132 CTCTGCTTCTTGAGGAGGGAAGG + Exonic
915695109 1:157732536-157732558 CTGTGTTTCTTAAACATTGAAGG + Intergenic
917640281 1:176976898-176976920 CTGTTTTTCTTGTACAGGGATGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919944756 1:202310971-202310993 CTGTGTTTCTGGAAGAGTTAGGG + Intronic
921360578 1:214327945-214327967 CTGTTTTTCTTGACCAGAGATGG - Intronic
921494814 1:215826402-215826424 CTGTGATTGTCAAACAGTGATGG + Intronic
1063894450 10:10665107-10665129 CTGTACTTAGTGAACAATGAAGG - Intergenic
1066002045 10:31113869-31113891 CTGTGCCTGTTGAACAAAGAAGG + Intergenic
1068170895 10:53393224-53393246 CTCTGCTTCTTGAGGAGAGAGGG + Intergenic
1071366403 10:84904847-84904869 GTGTGCTGCAGGAACAGTGAGGG - Intergenic
1073382752 10:103092750-103092772 CTGTGATTCTGGGGCAGTGATGG - Intronic
1074701989 10:116100719-116100741 CATTGCTGCTGGAACAGTGAGGG - Intronic
1076067179 10:127458251-127458273 CTGTGCTGCTAGAACAATCAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078391199 11:10937041-10937063 CTGTGCTTCTTAAAAACTCATGG - Intergenic
1078885775 11:15498346-15498368 CTGTTCTTGTTGGACAGAGATGG + Intergenic
1079515683 11:21265470-21265492 CTGTGGTTATTAAATAGTGATGG + Intronic
1080057910 11:27926551-27926573 CTGGGCTTTTTGAAAAGTGAGGG - Intergenic
1081645290 11:44786036-44786058 CTGTGCCTCATGCACAGCGAGGG + Intronic
1081670167 11:44938295-44938317 CTGTGCTTCTTCATCAGAGGCGG + Exonic
1082626524 11:55494207-55494229 CTGAAAGTCTTGAACAGTGAGGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083716228 11:64578523-64578545 CTGTGCTGCTTGAGTAGTGGTGG + Intergenic
1086237623 11:84650977-84650999 CTGTGCTTTTTAAAAAGTGATGG + Intronic
1086808346 11:91271733-91271755 CAGTGCTTTTGGAACATTGATGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088739361 11:112754321-112754343 CTTTGCTTCCTGAAAGGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091375411 12:21920-21942 CTCTGGTTATTGAACAGTGAGGG - Intergenic
1091595863 12:1878818-1878840 CTGCACTTCTTGGGCAGTGATGG + Intronic
1092170449 12:6370845-6370867 TTGGGGTTCTTGAACAATGAAGG - Intronic
1093276508 12:17134982-17135004 CTGTGCAACTTGACCAGTGGAGG + Intergenic
1094398379 12:30033676-30033698 GTGTGGTTCTTGGATAGTGAGGG + Intergenic
1095970409 12:47897854-47897876 CTGGGCTTCTTGATCATTTAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099075546 12:78102927-78102949 CTAGGCTTCTGGATCAGTGAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105869532 13:24491962-24491984 CTGTACTTCCTGTAGAGTGACGG - Intronic
1106414895 13:29538310-29538332 CGCTGCTTGTGGAACAGTGATGG + Intronic
1107489863 13:40870918-40870940 GGGTGCTTCTAGCACAGTGATGG + Intergenic
1107816425 13:44248882-44248904 ATGTGCTTTTTGAATAGGGAAGG - Intergenic
1108671067 13:52689284-52689306 TTTTTCTTCTTGAACACTGAAGG + Intronic
1108817820 13:54313287-54313309 CTGGGCTTCTGGAACAGGTAGGG + Intergenic
1109716032 13:66223664-66223686 CTCTGCTTCTTATACAGTGAAGG + Intergenic
1111259855 13:85723320-85723342 ATGTGCTTTTTGCACAGTGGTGG - Intergenic
1116866152 14:50033312-50033334 CTGTGCCACTTGTACTGTGACGG - Intergenic
1117796555 14:59400483-59400505 CTTTGATCCTTGGACAGTGATGG + Intergenic
1119799106 14:77426912-77426934 CTGAGCTTCTTATAAAGTGACGG + Exonic
1120405097 14:84084338-84084360 CTAGGTTTCTGGAACAGTGATGG + Intergenic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1123140498 14:106072998-106073020 CTGGGCTTCTGGACCTGTGATGG - Intergenic
1123688177 15:22815048-22815070 CAGTGCTTCTTGACCAGGGGTGG - Intronic
1123704668 15:22942536-22942558 GTGTGCTTCTGGAGCAGTGTGGG - Intronic
1126378216 15:48018103-48018125 CTATGCTTCCTGAGCATTGAGGG - Intergenic
1129779199 15:78258878-78258900 CAGTGTTTCTGGAACAGTGATGG - Intergenic
1130031335 15:80317211-80317233 CTGAGCTTCTTTAAGATTGAGGG - Intergenic
1130832618 15:87616895-87616917 CTGTGCTTCTTGAGCTGTTGAGG - Intergenic
1133528318 16:6628081-6628103 CTTTGCCTCCTGAACAGAGAAGG - Intronic
1135240135 16:20798132-20798154 CTTTTCTTCATGAATAGTGAAGG + Exonic
1135305155 16:21361671-21361693 CTGTGCTCCTTCAACAGCCAGGG + Intergenic
1136301899 16:29340836-29340858 CTGTGCTCCTTCAACAGCCAGGG + Intergenic
1140493178 16:75358258-75358280 CTGTGTTTCTTACACATTGAAGG - Intronic
1141572863 16:84944788-84944810 CAGTGGTTCTTGACCAGTGTGGG + Intergenic
1145050538 17:19656502-19656524 CTGTGACTCTTGAACTGGGAGGG + Exonic
1153382997 18:4458878-4458900 CTGCGCTTCTTCTATAGTGAGGG - Intergenic
1153589849 18:6661877-6661899 CTGTGCATCTGGTACAGAGATGG - Intergenic
1155809967 18:30220035-30220057 TTGTACTTCTTAAAAAGTGAAGG - Intergenic
1157995114 18:52545560-52545582 CAGTGCTTAATGAACATTGAAGG + Intronic
1158306796 18:56115053-56115075 CTGTGATTCTTCAAAATTGATGG + Intergenic
1158652402 18:59299662-59299684 TTGTGCTTCTTGCTCAGGGAAGG + Intronic
1161059677 19:2208639-2208661 CTCTGCTTCTGGAAGAGGGAGGG - Intronic
1163830321 19:19544418-19544440 CTGCGCTTCGTGGACAGCGACGG + Exonic
1164461720 19:28454721-28454743 CTGTGCCTGGTGAGCAGTGATGG - Intergenic
1165391470 19:35541532-35541554 CTGTGATTCTTGGCCAGTGTCGG - Intronic
1166914784 19:46187951-46187973 GTGTGCTACTTGATCAGAGACGG + Intergenic
1168487976 19:56780964-56780986 CTTGGCTTCTTTAACACTGAAGG - Intronic
925023088 2:587403-587425 CTGTGCTTCCTGCTCAGTGGTGG - Intergenic
925392412 2:3505516-3505538 CTGTGCTTCTGGCAGAGGGAGGG + Intronic
925663601 2:6229028-6229050 TTATGCTTCTTGATCTGTGATGG - Intergenic
926142428 2:10375680-10375702 CTGTCCCTGTTGTACAGTGAGGG - Intronic
927889446 2:26739122-26739144 CTGTGCTCCTGTGACAGTGAGGG - Intergenic
930464241 2:51725199-51725221 CTGTCCTGCTTTGACAGTGAAGG - Intergenic
930562599 2:52979496-52979518 CTGTGCCTCTTGAGCAGTTTGGG + Intergenic
931159792 2:59676357-59676379 CAGAGCTTTATGAACAGTGAAGG - Intergenic
931936943 2:67209190-67209212 GTGTGCTGATTGAAAAGTGATGG + Intergenic
940315761 2:152325989-152326011 CTGTGACCCTTGAACAGTGTGGG + Intergenic
941711676 2:168720945-168720967 CTATGCTTCGTGGCCAGTGATGG + Intronic
942609049 2:177723072-177723094 CTGTATTTCTTGGACAGGGAGGG + Intronic
944934026 2:204548675-204548697 TTTTGCTTCTGGAATAGTGATGG + Intronic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
946443787 2:219720236-219720258 CAGTGATTCTTGAACAGTGTAGG + Intergenic
947309191 2:228781881-228781903 CTGTAGTTGGTGAACAGTGAAGG + Intergenic
1169626281 20:7573368-7573390 TTCTGCTTATTGAATAGTGAAGG - Intergenic
1170413265 20:16113175-16113197 CTGTGCAGATTGAACAGAGATGG + Intergenic
1172063652 20:32204569-32204591 CTGTGCCTTTTGAAAAGTGTAGG - Intronic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1175896941 20:62341232-62341254 CTCAGCACCTTGAACAGTGACGG + Intronic
1177514740 21:22134786-22134808 CTGTTCTTTTAGCACAGTGAAGG + Intergenic
1178189132 21:30260307-30260329 CTGTGCTTCCTAAACTGAGATGG + Intergenic
1182466600 22:30520642-30520664 CAGTGCTTATTGAACTTTGATGG + Intergenic
1183386371 22:37517864-37517886 CTATGCCTGTTGAACAGTAAGGG - Intronic
949613617 3:5729699-5729721 CTGTTCTCCATGAACGGTGAAGG - Intergenic
950174742 3:10865100-10865122 CATTGCTTATTGCACAGTGATGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955567409 3:60262385-60262407 CTGTGCTTGCAGAAAAGTGATGG + Intronic
955864979 3:63372551-63372573 CTGTGCCTTGTGACCAGTGAGGG - Intronic
962084379 3:132174560-132174582 CTGTGCTTCTTGCTCTGTGGGGG - Intronic
962663604 3:137630927-137630949 CTGTGCTTTTTACAAAGTGAAGG - Intergenic
963565777 3:146928484-146928506 CTGTGGTTCTTGAGCAGAGCAGG + Intergenic
964243135 3:154619485-154619507 CTGGGCTTGTTGGACAGTGGGGG + Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
972618391 4:40722451-40722473 CTGTGCTCCTGGAACAGTGAAGG + Intergenic
974337469 4:60569281-60569303 CTGTGGTTCTTGCAGAGTCAGGG + Intergenic
974854113 4:67438899-67438921 CTGTGCTTCTTGCAGAGGGAGGG + Intergenic
975635915 4:76447975-76447997 CCTTGCTTCTTTAACAGAGAAGG + Intronic
979580702 4:122355952-122355974 CTGTGGTTCTTGAACATGAATGG - Exonic
982433969 4:155359711-155359733 CTGTGCTTCTTTAAAATAGATGG - Intronic
987934364 5:24444913-24444935 CTATGCTTCTTTGAAAGTGATGG - Intergenic
988945646 5:36195141-36195163 CTGTGCTTCTTGAACAGTGAAGG - Exonic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990892927 5:60666779-60666801 TTGTGCTTCTTGTAGCGTGATGG - Intronic
994998898 5:107102350-107102372 CTGTTCTACTTTAACAGAGATGG - Intergenic
995225416 5:109694983-109695005 CTGTGCTTTTTGGGAAGTGATGG + Intronic
996283741 5:121764163-121764185 CTGTGCTTCTGGAACATAGTGGG - Intergenic
998350143 5:141495046-141495068 TTGAGCTTCCTGAACAGTCAGGG - Intronic
998876739 5:146607783-146607805 CAGTGCTTCTTGATCATTTAAGG - Intronic
999697664 5:154200847-154200869 TTGTGTGCCTTGAACAGTGATGG + Intronic
999897081 5:156046409-156046431 CTGTGTTTTTTAAACATTGAAGG + Intronic
1004492604 6:16129981-16130003 ATGTGTTTCCTTAACAGTGAGGG + Intronic
1005905039 6:30255048-30255070 CTGTGCTTCTGGGTCTGTGATGG + Intergenic
1007473933 6:42106949-42106971 TTGTGCTTCCTGAACTGGGATGG + Exonic
1009790196 6:68392165-68392187 AAGTGGTCCTTGAACAGTGAGGG + Intergenic
1009858023 6:69289458-69289480 CTGTCCTTGTTGAATTGTGAAGG - Intronic
1012430494 6:99159074-99159096 CTGTGCTCCTTGGAGTGTGAGGG + Intergenic
1019406000 7:884413-884435 CTGTGCTCCCCGCACAGTGAAGG - Intronic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1024951530 7:54865848-54865870 CTGTGCCACTTGAACAGAGCCGG - Intergenic
1026417065 7:70193163-70193185 CTGTGGTCCTTGAACTCTGATGG + Intronic
1029503206 7:100946593-100946615 CTGTGTCTCCAGAACAGTGATGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030273074 7:107690877-107690899 CTGAGCTTTCTGAACACTGAAGG - Intronic
1032643082 7:133791560-133791582 CTATGCTTATTAAACAGTAATGG - Intronic
1035929997 8:3770039-3770061 CTGTGATTCCTGATCAGGGAAGG + Intronic
1036773816 8:11596447-11596469 CTGTGCTACAGGTACAGTGATGG + Intergenic
1039603936 8:38865651-38865673 GTGTGCTGCCTGAGCAGTGAAGG + Intergenic
1039680503 8:39730392-39730414 CTGAGCTACTGGAACAGGGAGGG - Intergenic
1040044468 8:42948252-42948274 CTGTGAATTTTAAACAGTGAAGG + Intronic
1041677776 8:60553025-60553047 CTGTGCTTTTTGAGAGGTGATGG + Intronic
1041787298 8:61649133-61649155 CTGTGCTACTGCAACAGTCATGG + Intronic
1045085158 8:98675038-98675060 CTGTGCTTTTGAAACAGTGAAGG - Intronic
1046104172 8:109646269-109646291 CTGTGCTCCTCGAAAACTGAGGG + Exonic
1046888911 8:119400305-119400327 CTATGCCTCTGGAACTGTGATGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051031840 9:12690159-12690181 CTGTGCTTTTTCCACAGTGCAGG + Intronic
1052276090 9:26678362-26678384 CTCTGCTCCTGTAACAGTGAAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056460694 9:86807141-86807163 GTGTGAGCCTTGAACAGTGACGG - Intergenic
1057592131 9:96381737-96381759 CTGTTCTCCTCGAACAGTGCTGG + Intronic
1059009754 9:110443934-110443956 TTGTGTTTCTTAAACACTGAGGG + Intronic
1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG + Intergenic
1059806246 9:117803703-117803725 ATATGCTTCTTGATCACTGAAGG + Intergenic
1059991324 9:119869011-119869033 CTGAGCTTCTTGACCAGCCAAGG + Intergenic
1185747689 X:2584980-2585002 CTGTGTCTCTTGTACAGGGAAGG + Intergenic
1185818231 X:3176587-3176609 AAGTGCTTAATGAACAGTGAAGG + Intergenic
1189483637 X:41412278-41412300 CTCAGCTTCTTGCACAGAGAAGG + Intergenic
1190107463 X:47570444-47570466 TTGTGCTTCTGGAATAGTCATGG + Intronic
1195404609 X:104499172-104499194 CTGTGTATCTTGAAAGGTGAAGG + Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1196295740 X:113994687-113994709 CTGTGCTTTTTTTCCAGTGAAGG - Intergenic
1200970786 Y:9150396-9150418 AGGTGCTGCTTGAACAGTCATGG + Intergenic
1201068913 Y:10126545-10126567 CTATGCTTCATGATCTGTGAAGG - Intergenic
1202140243 Y:21713917-21713939 AGGTGCTGCTTGAACAGTCATGG - Intergenic