ID: 988945727

View in Genome Browser
Species Human (GRCh38)
Location 5:36196307-36196329
Sequence TGGTACTTTAGCCATTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988945723_988945727 -7 Left 988945723 5:36196291-36196313 CCTCCTTGCCAACAATTGGTACT 0: 1
1: 0
2: 4
3: 35
4: 180
Right 988945727 5:36196307-36196329 TGGTACTTTAGCCATTCTGGTGG 0: 1
1: 0
2: 1
3: 32
4: 249
988945724_988945727 -10 Left 988945724 5:36196294-36196316 CCTTGCCAACAATTGGTACTTTA 0: 1
1: 0
2: 3
3: 71
4: 715
Right 988945727 5:36196307-36196329 TGGTACTTTAGCCATTCTGGTGG 0: 1
1: 0
2: 1
3: 32
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988945727 Original CRISPR TGGTACTTTAGCCATTCTGG TGG Intronic
901887296 1:12231262-12231284 TGGGACTCTGGCCAGTCTGGCGG + Intronic
905525620 1:38636608-38636630 TGTAATTTTAGCCATTCTGGTGG - Intergenic
906708514 1:47912483-47912505 TGGGACCTTGGCCTTTCTGGAGG + Intronic
907327398 1:53648323-53648345 TTAAATTTTAGCCATTCTGGTGG - Intronic
907498903 1:54863999-54864021 TATTATTATAGCCATTCTGGTGG - Intronic
908838294 1:68250930-68250952 TTTAATTTTAGCCATTCTGGTGG + Intergenic
909095893 1:71288777-71288799 TTTTATTGTAGCCATTCTGGAGG - Intergenic
911352049 1:96764996-96765018 TGGTACTTCTGCTATTCTGTTGG - Intronic
912730735 1:112100795-112100817 TTGGACTCTTGCCATTCTGGAGG + Intergenic
913319600 1:117578954-117578976 TGGTAATTCAGGCCTTCTGGAGG + Intergenic
913399774 1:118418514-118418536 TCTGACTTTAGCCATTCTGATGG - Intergenic
916291657 1:163173605-163173627 TGGTTCTTCACACATTCTGGTGG - Intronic
916743387 1:167665641-167665663 TTTTAATTTAGCCATTCTTGTGG + Intronic
917844587 1:179009972-179009994 TCAAATTTTAGCCATTCTGGTGG - Intergenic
918320837 1:183362971-183362993 TTTTATTATAGCCATTCTGGTGG + Intronic
918843665 1:189580466-189580488 TGGTACTTTTACCATTCTTCTGG - Intergenic
918858065 1:189784465-189784487 TTATTTTTTAGCCATTCTGGTGG + Intergenic
919300403 1:195756151-195756173 TGGTAATTAAGCACTTCTGGAGG + Intergenic
919609647 1:199729460-199729482 TTTAATTTTAGCCATTCTGGTGG - Intergenic
919987112 1:202683060-202683082 TTTTACTTTAGCCATTCTGGTGG - Intronic
920545175 1:206810467-206810489 TTGTCCTCTAGGCATTCTGGGGG - Intronic
921173536 1:212571141-212571163 TTCTATTTTAGCCATTCTGTTGG + Intronic
923468017 1:234266391-234266413 TGTTAGTTCTGCCATTCTGGTGG - Intronic
924263948 1:242261795-242261817 TTTTATTTTAGCCATTCCGGTGG - Intronic
924278607 1:242412988-242413010 TTTTATTTTGGCCATTCTGGTGG + Intronic
1063438410 10:6052968-6052990 TGGTCCTTAAGCCATCCTGCAGG + Intronic
1064466180 10:15584459-15584481 TGGTTTTTGAGCCAGTCTGGTGG - Intronic
1064526867 10:16266218-16266240 GGGTTCTTTAGCCAATATGGCGG - Intergenic
1066123557 10:32316164-32316186 TTCTATTTTAGCCATTCTGCTGG - Intronic
1066175282 10:32897046-32897068 TTAAACTTTAGCCATTCTAGTGG + Intergenic
1066551242 10:36559971-36559993 TGCTACTTTAGATCTTCTGGTGG - Intergenic
1066720847 10:38336670-38336692 TTTTATTTTAGCCATTCCGGTGG + Intergenic
1067320404 10:45214881-45214903 TTGGATTTTAGCCATTCTAGTGG - Intergenic
1068052617 10:51969731-51969753 TTATATTTTAGCCATTCTAGTGG - Intronic
1068359525 10:55958263-55958285 TGGTATTTTATTCATTCTAGTGG + Intergenic
1069594976 10:69664546-69664568 TGGTGCTTTGGCCAAGCTGGTGG + Intergenic
1069670741 10:70200853-70200875 TTTTATTTTAGCCATTCTGTTGG - Intergenic
1070600421 10:77862413-77862435 TTTTATTTTAGCCATTCTGATGG - Intronic
1071443364 10:85723943-85723965 CAGTACTTCAGCCATTCTTGAGG - Intronic
1071892188 10:90022228-90022250 TCTCATTTTAGCCATTCTGGTGG - Intergenic
1072589052 10:96810433-96810455 TTTCACTTTAGCCATTCTGGAGG - Intergenic
1072667442 10:97404190-97404212 TTTAATTTTAGCCATTCTGGTGG - Intronic
1073576355 10:104629110-104629132 TTCAATTTTAGCCATTCTGGTGG - Intergenic
1080113345 11:28594378-28594400 TGGTATTTTAGCCTTTAAGGAGG + Intergenic
1080572947 11:33572970-33572992 TCTTACTTTAGCCGTGCTGGTGG + Intronic
1081954995 11:47084086-47084108 TTGCATTTTAGCCATTCTAGTGG + Intronic
1088306143 11:108410224-108410246 TCTAATTTTAGCCATTCTGGTGG + Intronic
1091542853 12:1478228-1478250 TTAAATTTTAGCCATTCTGGTGG + Intronic
1092667410 12:10818060-10818082 TTTTACTATAGCCATTCTAGTGG - Intergenic
1094128298 12:27046835-27046857 TTTAACTTTAGCCATTCTAGTGG + Intronic
1094849801 12:34377266-34377288 TGGCACTTTCGCCCTTGTGGTGG + Intergenic
1099040757 12:77651656-77651678 TGGAATTTTAGCCAAGCTGGTGG + Intergenic
1100464008 12:94829112-94829134 TTTGACTATAGCCATTCTGGTGG - Intergenic
1101086084 12:101238352-101238374 TTTTATTTTAACCATTCTGGTGG - Intergenic
1101135648 12:101740304-101740326 TTGTAGTTTTGCCATTCTAGTGG - Intronic
1103270435 12:119668818-119668840 TGGGAATTTATCCATTTTGGAGG + Intronic
1103796560 12:123507021-123507043 TCTCATTTTAGCCATTCTGGTGG - Intronic
1104123502 12:125821395-125821417 GGTTACTTTAGCCAATCTTGGGG - Intergenic
1105012213 12:132763256-132763278 TTAAATTTTAGCCATTCTGGTGG - Intergenic
1105764561 13:23546496-23546518 TTACATTTTAGCCATTCTGGTGG + Intergenic
1108084279 13:46768707-46768729 CTGAACTTTAGCCATTCAGGTGG + Intergenic
1108524566 13:51275687-51275709 TTTAATTTTAGCCATTCTGGTGG - Intronic
1108989970 13:56642699-56642721 TTTTATTTTAGCCATTCTGATGG - Intergenic
1110698708 13:78522050-78522072 TGTTACTTTAGCAATTATGCAGG + Intergenic
1113918583 13:113890131-113890153 TTATACTTTAGCCATTCTAATGG + Intergenic
1117629399 14:57674177-57674199 TTTTATTTTAGCCATTCTGGTGG - Intronic
1117825691 14:59701152-59701174 TTTAATTTTAGCCATTCTGGTGG - Intronic
1118901403 14:69989213-69989235 TTTTATTTTAGCCATTCTAGTGG + Intronic
1119062048 14:71485052-71485074 TGATCCTTTAGCTATTTTGGAGG + Intronic
1119108665 14:71949345-71949367 TTGAATTTTAGCCATTCTGGTGG + Intronic
1119201433 14:72755720-72755742 TGGTTCTTTAGCCATGAAGGTGG + Intronic
1120423999 14:84323804-84323826 TGACTCTTTAGCCTTTCTGGAGG + Intergenic
1121292507 14:92787930-92787952 TTACATTTTAGCCATTCTGGTGG + Intergenic
1123869813 15:24559016-24559038 TTTTAATATAGCCATTCTGGCGG + Intergenic
1123954911 15:25325054-25325076 TGGTACTGTAGCCATGGTAGGGG + Intergenic
1124552169 15:30691724-30691746 TTGTAATTTAGACATTCTGGTGG + Intronic
1124679072 15:31713941-31713963 TGTAATTTTAGACATTCTGGTGG - Intronic
1125207329 15:37168720-37168742 TTTTATTTTAGCCATTCTGGAGG - Intergenic
1125548134 15:40523762-40523784 TTTAATTTTAGCCATTCTGGTGG - Intergenic
1126262174 15:46705972-46705994 TTTTACCTTAGCCATTCTGATGG - Intergenic
1126431269 15:48587511-48587533 TGGTACTGGAGCCCTTCTGTGGG - Intronic
1126688531 15:51268747-51268769 TTGAATTTTAGCCATTCTAGAGG + Intronic
1128048115 15:64637562-64637584 TTTCATTTTAGCCATTCTGGTGG + Intronic
1128380897 15:67111671-67111693 TTTTATTTTAGCCATTCTAGTGG + Intronic
1128844977 15:70884396-70884418 TGGTACATCAGCTATTCGGGAGG + Intronic
1129531602 15:76270055-76270077 TGGTGTTTTAGACATTTTGGTGG - Intronic
1129646594 15:77439904-77439926 TTTTATTTTAGCCATTCTGGTGG + Intronic
1130385793 15:83410732-83410754 TTTCACTGTAGCCATTCTGGTGG + Intergenic
1130565468 15:84990909-84990931 TTTAATTTTAGCCATTCTGGTGG + Intronic
1132151552 15:99465525-99465547 TTGTATTTCAGCCATTCTGATGG - Intergenic
1135399680 16:22157695-22157717 TTTTATTTTAGCCATTCTAGTGG - Intergenic
1135832061 16:25783536-25783558 TGATACTTTAGCTACTCTTGGGG + Intronic
1135902308 16:26473781-26473803 TTTAACTTTAGGCATTCTGGTGG - Intergenic
1136535133 16:30894574-30894596 TTTCACTTTAGCCATTCTGGTGG - Intronic
1137311936 16:47271427-47271449 TTTTATTTTAGCCATCCTGGTGG - Intronic
1138157940 16:54723039-54723061 TTTCAGTTTAGCCATTCTGGTGG + Intergenic
1138357821 16:56399127-56399149 TGTTATTATAGCCATTCTCGTGG - Intronic
1138640466 16:58381986-58382008 TTTCATTTTAGCCATTCTGGTGG + Intronic
1143399409 17:6633360-6633382 TGTCTCTTTAGCCATTCTGGTGG - Intronic
1144611442 17:16721456-16721478 TGAAATTTTAGCCATTCTGATGG + Intronic
1144696780 17:17309590-17309612 TTTTACTTTAGCCATCCTTGTGG + Intronic
1144901296 17:18593901-18593923 TGAAATTTTAGCCATTCTGATGG - Intergenic
1145131206 17:20352196-20352218 TGAAATTTTAGCCATTCTGATGG + Intergenic
1146293159 17:31627421-31627443 TTTCATTTTAGCCATTCTGGTGG - Intergenic
1146413316 17:32608438-32608460 TGTTATTTTAGCCATTCTGATGG - Intronic
1148640983 17:49187228-49187250 TTAAATTTTAGCCATTCTGGTGG - Intergenic
1149202242 17:54200632-54200654 TGGCAGTGTAGCCATTTTGGCGG + Intergenic
1150023711 17:61648876-61648898 TTTCACTTTAGCCATTCTGGTGG + Intergenic
1152063586 17:78097455-78097477 TGGTATTTTAAGCATTCTGGCGG + Intronic
1152501442 17:80712844-80712866 TTGGATTTTAGCCATTCTGGTGG + Intronic
1155255666 18:23996088-23996110 TTTTATTTTAGCCATTCTGTAGG + Intronic
1155525206 18:26709075-26709097 TTTTAATTTAGCCATTCTGGTGG + Intergenic
1156024844 18:32640648-32640670 TTTTATTTTAGCCATTCTGATGG + Intergenic
1157453529 18:47805932-47805954 TGGTACATTGGCCATTATGGAGG + Intergenic
1158353331 18:56588045-56588067 TTTAACTTTAGCCATTCTAGGGG - Intergenic
1164769585 19:30797977-30797999 AGGTGCTTTAGCCCTTCTTGGGG + Intergenic
1165208050 19:34208134-34208156 TCGTGCTTTAGACCTTCTGGTGG - Intronic
1166611443 19:44202539-44202561 TTTTACTGTAGCCAATCTGGTGG - Intergenic
928954931 2:36856129-36856151 TTTAACTTTAGCCATTCTGGTGG - Intronic
929950091 2:46402987-46403009 TTCAACTTTAGCCATTCTAGTGG - Intergenic
930497261 2:52161783-52161805 TTCAATTTTAGCCATTCTGGTGG + Intergenic
930882055 2:56281601-56281623 TTTTATTTTAGCCATTCTAGTGG + Intronic
930893159 2:56414623-56414645 TTCTAATTTAGCCATTCTAGTGG + Intergenic
931098581 2:58970068-58970090 TTTTACTTTAGCAATTCTGTTGG - Intergenic
931534366 2:63256412-63256434 TTTTATTTTAGCCATTCCGGTGG - Intronic
931733392 2:65172960-65172982 TTTTATTTTAGCCATTCTGCTGG + Intergenic
932082558 2:68728295-68728317 TTTTATTTTAGCCATTCTAGTGG - Intronic
932774894 2:74522450-74522472 TGGTTCTTTAGGCATTGTGAGGG + Intronic
933111522 2:78407904-78407926 TGGTTGTTTAGCCATCCTGGTGG + Intergenic
934741090 2:96723222-96723244 TTTTATTTTAGCCATTCTAGCGG + Intronic
935320222 2:101879883-101879905 TTGCAGTTTAGCCATTCTGAAGG + Intronic
935558994 2:104541541-104541563 TGGTCCTTTAGCTTTTCTTGGGG + Intergenic
938121046 2:128633938-128633960 TGTAATTTTAGCAATTCTGGGGG + Intergenic
938685762 2:133736139-133736161 TTTAATTTTAGCCATTCTGGTGG - Intergenic
941213701 2:162677822-162677844 TGGTATTTTAGCCATCCCAGTGG + Intronic
942716385 2:178897220-178897242 TGGTGCTTATGCTATTCTGGTGG - Intronic
943542631 2:189236537-189236559 TGTCATTTTAGCCAGTCTGGTGG + Intergenic
944419777 2:199517267-199517289 TTGAATTTTAGCCATTCAGGTGG + Intergenic
945382293 2:209155345-209155367 TTTTACTATAGGCATTCTGGTGG - Intergenic
946979009 2:225186569-225186591 TTTTATTTTAGCCATTCTGATGG - Intergenic
946996505 2:225398366-225398388 TGATAATTTTGCCAGTCTGGGGG - Intergenic
947124833 2:226857250-226857272 TTTTACTGTAGCCATCCTGGTGG - Intronic
947576505 2:231279171-231279193 CGCTAGTATAGCCATTCTGGAGG - Intronic
947955065 2:234182425-234182447 TGCAACTTTAGCCACTCTGATGG + Intergenic
948536271 2:238650114-238650136 TGTGACTTTAGGCATCCTGGTGG + Intergenic
1169398943 20:5263126-5263148 TTTAATTTTAGCCATTCTGGAGG + Intergenic
1169489671 20:6060732-6060754 TTGAATTTTGGCCATTCTGGTGG - Intergenic
1169884141 20:10379407-10379429 TTTAACTTTAGTCATTCTGGTGG - Intergenic
1170525534 20:17232356-17232378 TTTTCTTTTAGCCATTCTGGTGG + Intronic
1171158682 20:22900923-22900945 TAGGAATTTATCCATTCTGGTGG - Intergenic
1172089721 20:32421367-32421389 TTTTATTTTAGCCATTCTAGTGG - Intronic
1172201564 20:33130566-33130588 TTACACTTTAGCCATTCTGGTGG - Intergenic
1173267804 20:41501829-41501851 TAGCATGTTAGCCATTCTGGTGG + Intronic
1174134648 20:48371381-48371403 CGGTAATTTAGCCATGCAGGAGG + Intergenic
1174148682 20:48470355-48470377 TGGGATTTTTGCCAGTCTGGTGG - Intergenic
1178964783 21:37106089-37106111 TTTTATTTTAGACATTCTGGTGG + Intronic
1180726051 22:17947278-17947300 TGGCAGTTTGGCCATGCTGGGGG - Intronic
1181835158 22:25599831-25599853 TTTTATTTTAGCCATTTTGGTGG - Intronic
1181875053 22:25934016-25934038 TGGCATTTTAGCCATTCCGAGGG + Intronic
1182405623 22:30126863-30126885 TAAGATTTTAGCCATTCTGGTGG + Intronic
1182808687 22:33097320-33097342 TGATAATTCTGCCATTCTGGGGG - Intergenic
1183002270 22:34870752-34870774 TGAAATTTTAGGCATTCTGGAGG - Intergenic
1183615282 22:38941143-38941165 TTGGATTTTAGCCATCCTGGTGG + Intergenic
1183798641 22:40142479-40142501 TTTTATTTTAGCCATTCTAGTGG - Intronic
1184316448 22:43696267-43696289 TCTTATTTTAGCCATTCTAGAGG - Intronic
1184448525 22:44568810-44568832 TTAAATTTTAGCCATTCTGGTGG - Intergenic
1184634298 22:45814431-45814453 TTTTAAATTAGCCATTCTGGTGG - Intronic
949158711 3:856143-856165 TGGGATTTTTGCCAGTCTGGTGG - Intergenic
950225632 3:11231514-11231536 TTTTATTTTAGCCATTCTGATGG + Intronic
950727872 3:14929526-14929548 TAAAATTTTAGCCATTCTGGTGG + Intronic
950793298 3:15490692-15490714 TTTTGCTTTAGCCATTCTGGTGG - Intronic
951598887 3:24350182-24350204 TTTAATTTTAGCCATTCTGGTGG - Intronic
953111066 3:39938812-39938834 TTTCACTTTAGCCATTCTGATGG + Intronic
953508413 3:43509510-43509532 TTTTATTTTAGCCATTCTGATGG - Intronic
953524331 3:43675709-43675731 TTTTATTTTAGCCATTCTGATGG - Intronic
953524333 3:43675735-43675757 TTTTATTTTAGCCATTCTGATGG - Intronic
953822960 3:46224255-46224277 TTTCATTTTAGCCATTCTGGTGG - Intronic
955641098 3:61085319-61085341 TTTTACTTTAGCCATCCTAGTGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
956906594 3:73772168-73772190 TTTAACTTTAGCCATTCTGGAGG + Intergenic
956988930 3:74739800-74739822 TTTTAATTTAGCCATTCTAGTGG + Intergenic
961915697 3:130372131-130372153 TGTTATTATAGCCATTCTAGTGG - Intronic
962446023 3:135466279-135466301 TGTCATTTTAGCCATTCTGGTGG - Intergenic
963060963 3:141226104-141226126 TTTAATTTTAGCCATTCTGGTGG - Intergenic
968240070 3:197071751-197071773 TTTCATTTTAGCCATTCTGGTGG - Intronic
968807102 4:2781274-2781296 TGGTAATTTAGCCACTTTAGAGG + Intergenic
973948199 4:55982451-55982473 TTGTATTATAGTCATTCTGGTGG + Intronic
974170092 4:58255256-58255278 TTGGACTTTAGCCATTCTACTGG - Intergenic
975792609 4:77970895-77970917 TTTTATTTTAGCTATTCTGGTGG + Intergenic
975797503 4:78024229-78024251 TTTTATTTTAGCCATTCTGATGG + Intergenic
976284424 4:83357537-83357559 TAAAATTTTAGCCATTCTGGTGG + Intergenic
976756428 4:88502702-88502724 TTTTAAATTAGCCATTCTGGTGG + Intronic
980142805 4:128941335-128941357 TTTAATTTTAGCCATTCTGGTGG + Intronic
980158626 4:129134579-129134601 TGGCACTTTAGCTAATCTAGGGG + Intergenic
980648594 4:135679481-135679503 TTGTACTTTAGGAATTCTAGGGG + Intergenic
982638816 4:157930911-157930933 TTTTACTTTAGCCATTCAAGTGG + Intergenic
983113109 4:163778383-163778405 TTGAATTTTAGCCATTCTAGTGG + Intronic
984577167 4:181464328-181464350 TTTTATTTTAGCCATTCTGGTGG + Intergenic
987144021 5:14973836-14973858 TGAAATTTTAGCCATTCTGGTGG - Intergenic
987385798 5:17328214-17328236 TTTTATTGTAGCCATTCTGGTGG - Intergenic
988065096 5:26222400-26222422 TGGGATTTTTGCCAGTCTGGTGG - Intergenic
988147810 5:27332128-27332150 TTATATTTTAGTCATTCTGGTGG + Intergenic
988779440 5:34506433-34506455 TGGTACTTTTTCCACTGTGGTGG - Intergenic
988945727 5:36196307-36196329 TGGTACTTTAGCCATTCTGGTGG + Intronic
990403443 5:55464090-55464112 TGTTATTTTAGCCATTCTAAGGG - Intronic
997125107 5:131218357-131218379 TGTTATTTTAGTCATTTTGGGGG - Intergenic
998118185 5:139554849-139554871 TTTTATTTTAGCCATTCTAGTGG + Intronic
999332534 5:150685983-150686005 CTGAATTTTAGCCATTCTGGTGG - Intergenic
999523242 5:152374557-152374579 TGTTATTATAGCCATTCTAGTGG - Intergenic
1000467133 5:161593516-161593538 TTTAACTTTAGCCATTCTGGTGG - Intronic
1003228564 6:4228848-4228870 TTTTATTTTAGCTATTCTGGAGG - Intergenic
1003950741 6:11113309-11113331 TTTTAATTTAGCCATTCTAGAGG + Intronic
1005138949 6:22604417-22604439 TTTAATTTTAGCCATTCTGGTGG + Intergenic
1005225651 6:23638985-23639007 TGCTCCTTGAGCCATACTGGGGG + Intergenic
1005258428 6:24030187-24030209 TTAAATTTTAGCCATTCTGGTGG + Intergenic
1005669003 6:28085918-28085940 TGGAACTTTATCCATTATGGAGG - Intronic
1006125879 6:31837820-31837842 TGGTGCTTAAGCCATTCATGAGG + Intronic
1009924548 6:70104083-70104105 TTTCACTTTAGCCATTCTAGTGG + Intronic
1009996702 6:70903707-70903729 TTTCATTTTAGCCATTCTGGTGG - Intronic
1012395094 6:98787399-98787421 TAGTATTTTAGCCATGCTAGTGG - Intergenic
1014156646 6:118118246-118118268 TATAACTTTAGCCATTCTAGTGG + Intronic
1014374950 6:120660736-120660758 TGGTATTTTAGACATGATGGAGG + Intergenic
1014956574 6:127625508-127625530 TTAAACTTTAGCCATTCTAGTGG + Intergenic
1015807469 6:137125769-137125791 TTTAATTTTAGCCATTCTGGTGG - Intergenic
1020155628 7:5721711-5721733 TTTAATTTTAGCCATTCTGGTGG + Intronic
1021549759 7:21858193-21858215 TGAAACTTTAGCCATTCTGTGGG - Intronic
1021552806 7:21889574-21889596 TTTTATTTTAGCCATTCTGGTGG + Intronic
1021730506 7:23591071-23591093 TTCTGTTTTAGCCATTCTGGTGG + Intergenic
1023133030 7:37022545-37022567 TTTTATTTTAGCCCTTCTGGTGG - Intronic
1023937977 7:44753029-44753051 TTTTATTTTAGCCATTCTGATGG + Intronic
1024282317 7:47729621-47729643 TTGTATTTTAGCCATCCTAGTGG + Intronic
1028492637 7:91430118-91430140 TGGTATTTTATCCGTTCTGGTGG - Intergenic
1028715819 7:93966752-93966774 TGGTAGTTTAGCAATACAGGGGG + Intronic
1031801385 7:126250658-126250680 TGTCATTTTAGCCTTTCTGGTGG - Intergenic
1031808346 7:126334838-126334860 TGGCACTTTGGCCTTTCTGCTGG - Intergenic
1032338324 7:131046785-131046807 TTTAATTTTAGCCATTCTGGTGG + Intergenic
1032538513 7:132684458-132684480 AGGAACTTTATCCATTCTGCAGG - Intronic
1033343005 7:140506500-140506522 TGGTCCTTTAAAGATTCTGGGGG + Intergenic
1034265888 7:149780481-149780503 GGGTCCTTGAGCCATGCTGGGGG + Intergenic
1035939557 8:3882365-3882387 TTGTATTTTAACCATTCTAGTGG - Intronic
1036955035 8:13178755-13178777 TTTCATTTTAGCCATTCTGGAGG - Intronic
1037133443 8:15434133-15434155 TTAAACTTTAGCCATTCTAGTGG + Intronic
1037296445 8:17406454-17406476 TTTTATTTTAGCCATTCAGGTGG - Intronic
1037746342 8:21648191-21648213 TGGTATTTTAGCAATTCTGCTGG - Intergenic
1038459020 8:27700748-27700770 TGAAATTTTAGCCATTCTAGTGG - Intergenic
1040759269 8:50818749-50818771 TGGTACTTTTTTCATTCTTGGGG + Intergenic
1041046253 8:53889217-53889239 TTTAACTTTAGTCATTCTGGTGG + Intronic
1041791826 8:61704786-61704808 TTTAATTTTAGCCATTCTGGTGG - Intronic
1043565611 8:81544259-81544281 GGGTACTCTAGACGTTCTGGAGG + Intergenic
1045138189 8:99246919-99246941 TGGTACTTTAGGCAATCTATTGG + Intronic
1045786461 8:105926901-105926923 TTTTACTTTACCCATTCTTGTGG - Intergenic
1046360188 8:113143283-113143305 TTTTATTTTAGCCATTCTGGTGG - Intronic
1046390901 8:113571373-113571395 TTTAACTTTAGCCCTTCTGGTGG - Intergenic
1046560023 8:115824366-115824388 TGGAACTTTAGTGATACTGGTGG + Intergenic
1052394186 9:27917873-27917895 TTTAATTTTAGCCATTCTGGTGG + Intergenic
1053119310 9:35534136-35534158 TTTTATTTTAGCCATTCTAGTGG + Intronic
1056303229 9:85263553-85263575 ATGTACTTTACCCATTCTGAGGG - Intergenic
1057124328 9:92604217-92604239 TTTTATTTTAGCCATTCTGATGG + Intronic
1057281427 9:93714582-93714604 TTTTATTTTAGCCATTCTGATGG + Intergenic
1057579355 9:96272537-96272559 TTTTACTTTAGCCATTATGATGG - Intronic
1057736549 9:97667311-97667333 TAGTATTTTAGCCATTTTGGAGG + Intronic
1057864839 9:98671668-98671690 TTGGATTTTAGCCATCCTGGTGG + Intronic
1059648114 9:116287318-116287340 GGGTCCATTAGCCCTTCTGGGGG + Intronic
1060340731 9:122774277-122774299 TTTCATTTTAGCCATTCTGGTGG - Intergenic
1203793179 EBV:162349-162371 TGACCCTTTAGCCACTCTGGGGG + Intergenic
1188583753 X:31747903-31747925 TGGTACTGCAGCCTTTCTGCAGG - Intronic
1188969343 X:36594460-36594482 TTAAATTTTAGCCATTCTGGTGG + Intergenic
1189295239 X:39913192-39913214 GGGCACTGTTGCCATTCTGGAGG - Intergenic
1189361518 X:40357032-40357054 TTAAACTTTAGCCATTCTAGTGG - Intergenic
1189525873 X:41821381-41821403 TTTAATTTTAGCCATTCTGGTGG - Intronic
1189565032 X:42232872-42232894 TGGTACTTCAGGGTTTCTGGTGG + Intergenic
1189725006 X:43959468-43959490 TGATACCTTAACCATGCTGGAGG - Intronic
1190840291 X:54137763-54137785 TTTTACTTTAGCCATTTTGGTGG - Intronic
1192421473 X:71035776-71035798 TAACATTTTAGCCATTCTGGTGG - Intergenic
1193356791 X:80528772-80528794 TTTTATTTTAGCCATTCTAGTGG + Intergenic
1193778000 X:85667732-85667754 TTTAATTTTAGCCATTCTGGTGG + Intergenic
1194909289 X:99619431-99619453 TTTTATTTTAGTCATTCTGGTGG - Intergenic
1195293487 X:103451929-103451951 TTTTACTTTAGCCATTCTCATGG + Intergenic
1197619264 X:128728929-128728951 TTTAATTTTAGCCATTCTGGTGG + Intergenic
1198413784 X:136398591-136398613 TTTAATTTTAGCCATTCTGGTGG - Intronic
1198668987 X:139057340-139057362 TTTAATTTTAGCCATTCTGGTGG - Intronic
1198817338 X:140606277-140606299 TTTTACTTTAGTCATTCTGATGG + Intergenic
1199224810 X:145360214-145360236 TTGTATTTTAGCTACTCTGGTGG - Intergenic