ID: 988947944

View in Genome Browser
Species Human (GRCh38)
Location 5:36225373-36225395
Sequence TTGACCATGTTCACATTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988947944 Original CRISPR TTGACCATGTTCACATTCTT GGG (reversed) Intronic
902167687 1:14585533-14585555 TTGAATGTGTTCACACTCTTTGG - Intergenic
902491408 1:16784645-16784667 TTGTCTATGTTCACAATCATAGG + Intronic
902647666 1:17813207-17813229 TTTACCTTGTTCCCAGTCTTAGG + Intronic
904035018 1:27554202-27554224 ATGTCCCTTTTCACATTCTTAGG - Intronic
908851256 1:68378714-68378736 TTAAACAAGTTCACATTCATAGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909588847 1:77322517-77322539 TTTACCATGTGGAGATTCTTGGG + Intronic
909638244 1:77842373-77842395 TTGAAAAAGTTCAAATTCTTTGG - Intronic
911143249 1:94528276-94528298 TTGACATTGTTCAATTTCTTTGG + Intergenic
913115315 1:115691516-115691538 TTGACCATCTGCACTTTATTTGG + Exonic
913492762 1:119396969-119396991 TTGACCATGATCCCAGTGTTAGG + Intergenic
913503288 1:119491686-119491708 TTGACCATGATCCCAGTGTTAGG + Intergenic
914489229 1:148140047-148140069 TTGACCAACTTCACACTATTTGG - Intronic
916443942 1:164854721-164854743 TTGCCCAGGACCACATTCTTTGG + Intronic
918960125 1:191264634-191264656 CTGACCCTGTTCTCAATCTTAGG + Intergenic
919654161 1:200181085-200181107 TTGACCATGTACATCTTCATGGG + Intergenic
921805320 1:219447330-219447352 TTGCTCATGTTTAAATTCTTGGG - Intergenic
921840891 1:219827298-219827320 ATGATCAAGTTCATATTCTTTGG + Intronic
922077671 1:222263946-222263968 CTGAGCATGTTCTCATTCTGAGG + Intergenic
923529035 1:234797897-234797919 TTGTCTATGTTCACAATCATAGG - Intergenic
923682007 1:236125996-236126018 TTTACCATGTTCACTTTGTGGGG - Intergenic
924657325 1:245984759-245984781 TTGAACATGTTTATATGCTTAGG - Intronic
1066304443 10:34126540-34126562 GGGACCATGATCTCATTCTTTGG - Intronic
1067225036 10:44370315-44370337 TGGACCATTTTCACATTATCTGG + Intronic
1069448197 10:68494001-68494023 ATGACCATGTACAGATTTTTTGG + Intronic
1069642974 10:69968200-69968222 TGTGCCATGTTCACATCCTTAGG + Intergenic
1070061381 10:72986485-72986507 TGAACCATCTTTACATTCTTGGG + Intergenic
1070226419 10:74512121-74512143 TGGACCATCTTTGCATTCTTGGG + Intronic
1072095746 10:92177737-92177759 TTGGCCAAGTTCCCATTTTTTGG - Intronic
1074171611 10:110944989-110945011 TTGAGCATGTACACAGCCTTAGG + Intronic
1074280792 10:112049617-112049639 TTGCCTATGTTCACCTTCTCTGG - Intergenic
1079927345 11:26511032-26511054 TAGTCCACATTCACATTCTTAGG + Intronic
1080988487 11:37501170-37501192 AAGACCATATTCACATTCTGAGG + Intergenic
1081179526 11:39968780-39968802 TTGACCTTGATCCCCTTCTTGGG - Intergenic
1081230582 11:40581186-40581208 TTGAACATGTTGACATTCGATGG - Intronic
1085343106 11:75746556-75746578 TTAAGCACGTTCACATTGTTGGG + Intergenic
1089704063 11:120264729-120264751 TTGACCAAGTTCACATAGCTTGG + Intronic
1090106967 11:123863885-123863907 TTGATAATGTTCTCATTCTTGGG + Intergenic
1090489498 11:127145886-127145908 TTGACCATGTACATATTCAGTGG + Intergenic
1091710227 12:2734704-2734726 TTAAGCATGTTCACATTGTTGGG + Intergenic
1092561378 12:9617638-9617660 TTGACCATCTTCCAATTCTGTGG + Intergenic
1092713049 12:11357909-11357931 ATATCCATGTTCACATTCTCAGG + Intronic
1093619558 12:21272860-21272882 TTAATCATTTTCACATTTTTAGG + Intronic
1094189733 12:27685535-27685557 TTGAATTTGTTCACATTCTCAGG - Intronic
1095223065 12:39641745-39641767 TTGATCATATTAACATTATTGGG - Intronic
1097947103 12:65381322-65381344 ATGATCATGGTCACCTTCTTTGG + Intronic
1099106445 12:78502510-78502532 TTCACCATCTTCCAATTCTTAGG - Intergenic
1100377707 12:94032600-94032622 TTTTCCATGTTCTCTTTCTTTGG - Intergenic
1106223110 13:27763713-27763735 CTGACCAAGATCAAATTCTTGGG + Intergenic
1108840903 13:54613610-54613632 TTGACCATTTAGAGATTCTTTGG - Intergenic
1109234851 13:59803234-59803256 TTCACCCTGTTCATATTCTAGGG - Intronic
1111574199 13:90129073-90129095 TTGAAGATTTTCATATTCTTAGG - Intergenic
1113745173 13:112739351-112739373 TTGACCATCTTTTCATTCATTGG - Intronic
1114269786 14:21093591-21093613 TGGACCCCCTTCACATTCTTTGG + Exonic
1114996614 14:28361148-28361170 TTTCCCATGTTTACATCCTTAGG - Intergenic
1115458038 14:33627959-33627981 TTCACCATGTTTGCATTTTTGGG - Intronic
1115628813 14:35222670-35222692 TTGCCCAAGTTCTGATTCTTTGG + Intronic
1119369112 14:74123137-74123159 CTGATCATATTTACATTCTTAGG + Intronic
1120462888 14:84819772-84819794 TTGGCTGTGTTCACATTTTTGGG - Intergenic
1120695008 14:87634869-87634891 TTTACAATGTTTAAATTCTTGGG - Intergenic
1121836238 14:97094939-97094961 TTAACAATGTTCATATGCTTTGG + Intergenic
1202881358 14_KI270722v1_random:63734-63756 TGAACCATGTTGGCATTCTTGGG + Intergenic
1127759411 15:62122993-62123015 TTTACCATAATCACATTTTTGGG - Intergenic
1129042685 15:72703550-72703572 ATGACTATTTTCAGATTCTTTGG + Intronic
1129943827 15:79522139-79522161 TTTTCCAAGTTCACAGTCTTTGG - Intergenic
1131947416 15:97640411-97640433 TAGTCTATGTTCACATTCTTTGG + Intergenic
1133488300 16:6241834-6241856 TTCACCATGTTTACATGCATGGG - Intronic
1135554701 16:23426360-23426382 TTAACCATTCTCACATTCCTGGG - Intronic
1136985755 16:35102790-35102812 TTCACCATGTACTCATTCGTAGG - Intergenic
1138778760 16:59756817-59756839 ACGGCCATGTTCACATTTTTAGG + Intergenic
1139085345 16:63578081-63578103 TTGACCATCTTCCTATTCTGTGG - Intergenic
1140090753 16:71836676-71836698 TTGCCCATGGTCACATGATTAGG + Intergenic
1141587474 16:85044403-85044425 TTGACAATGTTTCCTTTCTTGGG + Intronic
1142734370 17:1886346-1886368 TTGACCATGTCAAAAATCTTAGG - Intronic
1144234250 17:13241814-13241836 TTGACCATGTTAAGTTGCTTTGG + Intergenic
1144242218 17:13323704-13323726 CTGAGCATGTTCACAGTCCTAGG + Intergenic
1147862334 17:43530845-43530867 TTCACCATCTTCTCATTCATAGG - Intronic
1151130707 17:71893672-71893694 TCTACCATGGTCAAATTCTTAGG + Intergenic
1153810193 18:8745682-8745704 TTGAACATGTGCACATCCTATGG - Intronic
1154052779 18:10977566-10977588 TTCACCAGGTTCACATCTTTTGG - Intronic
1155112493 18:22729898-22729920 GTCTCCATGTCCACATTCTTGGG - Intergenic
1156561832 18:38134206-38134228 ATGACCTTGTTCACATTTCTGGG + Intergenic
1156803007 18:41141244-41141266 TTAATCATGTTCAAATTCTCAGG - Intergenic
1157052170 18:44179078-44179100 TTGACCTGGCTCACATTCTCAGG + Intergenic
1160306502 18:77744542-77744564 TTAAACATGCTCACATTCTCAGG + Intergenic
1160340302 18:78083795-78083817 TTGATGATGTGCACATCCTTGGG + Intergenic
1164247654 19:23447619-23447641 TTGAAAATGTTCCCATTTTTGGG - Intergenic
1165210737 19:34233813-34233835 CTGACCATGTTGACACTATTTGG + Intergenic
1202656969 1_KI270708v1_random:32839-32861 TGAACCATGTTGGCATTCTTGGG + Intergenic
928252407 2:29693151-29693173 CTGATAATGTTCAGATTCTTCGG + Intronic
931526194 2:63156905-63156927 TTTACCATGTTTCCAATCTTAGG + Intronic
933282841 2:80351443-80351465 TTCACCATGGCCACATTCCTGGG + Intronic
938448730 2:131397778-131397800 TTGCTAATGTTCACATTTTTAGG + Intergenic
940026415 2:149213214-149213236 TGGACCATGTTTACATTTTGAGG + Intronic
940116629 2:150216296-150216318 TTGACTGTGTTCACACTTTTAGG - Intergenic
941027503 2:160474556-160474578 TTGAATACGTTCACATTATTAGG - Intronic
941043087 2:160645122-160645144 TTGTCCCTGTTCACATGCTTGGG + Intergenic
941542176 2:166800594-166800616 TTGAGCACGTTCCCATTCTATGG - Intergenic
942877377 2:180817207-180817229 TTCAGTATATTCACATTCTTGGG - Intergenic
944908142 2:204283223-204283245 TAGACCATGTTCTCACTCATAGG - Intergenic
945416382 2:209578148-209578170 GTGACCTTGGTCATATTCTTTGG + Intronic
945756889 2:213857400-213857422 TTGACCATGTTGAAAATCCTAGG + Intronic
945981423 2:216315110-216315132 TTGACCTTTTTCCCCTTCTTTGG - Intronic
946452567 2:219793562-219793584 TCAACCAGGTTCACATTCCTGGG + Intergenic
1169604614 20:7302642-7302664 CTGACAATTTTCACACTCTTGGG + Intergenic
1169661971 20:7989228-7989250 TTGACCATCTTCTAATTCTTTGG - Intronic
1169790120 20:9401415-9401437 CAGACCTTGTTCACAATCTTGGG - Intronic
1171296082 20:24018443-24018465 ATGACCATCTTCCCATCCTTTGG + Intergenic
1172641680 20:36443963-36443985 TTGCCCACGTTCACATTGTGAGG + Intronic
1173880955 20:46411931-46411953 ATGACCATGTTGCCCTTCTTTGG + Intronic
1175058841 20:56222896-56222918 TTGTGCATGTGCTCATTCTTTGG - Intergenic
1178738994 21:35179174-35179196 TTGGACATGGTCTCATTCTTGGG - Intronic
1178747595 21:35267949-35267971 TTGAGCATGTTTTCATTGTTGGG - Intronic
1179536675 21:42057291-42057313 TGGACTTTCTTCACATTCTTTGG + Intergenic
1182039501 22:27225475-27225497 TTCACACTGTTAACATTCTTTGG + Intergenic
1184306149 22:43603540-43603562 TTGAGTATGTTCACATTGATTGG + Intronic
949657396 3:6236587-6236609 TTTACCATCTTCACTTTTTTTGG + Intergenic
950011973 3:9730753-9730775 TTGCCCACGTTCACATTGCTAGG + Intergenic
952421928 3:33140063-33140085 TTGAAAATGTTCACAGCCTTAGG - Intronic
956562071 3:70590209-70590231 TTGAACATGTTGAGATTATTGGG + Intergenic
956900672 3:73712743-73712765 TTGACCATGGTCAAATTATTTGG - Intergenic
957216009 3:77320317-77320339 CTGACCATTTTCAAGTTCTTAGG + Intronic
959351350 3:105268699-105268721 TGAAACATGTTCACCTTCTTAGG + Intergenic
960656061 3:120005103-120005125 TTCACCATGTTCTCATACTCTGG - Intronic
962022837 3:131518081-131518103 TTTGCCATGTTCACATTCAGGGG - Intergenic
963274560 3:143317258-143317280 GTGACCATGTTCTCATTTCTTGG - Intronic
965532032 3:169780859-169780881 TTGAACGTGTTAACATTGTTTGG - Intronic
966033436 3:175378941-175378963 TTCAACATGTCCACATTATTTGG + Intronic
966167823 3:177041040-177041062 TTGACTATGTTTACTTTGTTGGG - Intronic
967680818 3:192361793-192361815 TTGATCACATTCACATTATTTGG + Intronic
969147878 4:5139911-5139933 TTGACCATTTTCAGATTCTGCGG + Exonic
972727511 4:41758133-41758155 TTGGCCAGGCCCACATTCTTGGG + Intergenic
973606304 4:52590636-52590658 GAGAGCATGGTCACATTCTTAGG - Intergenic
976419299 4:84821002-84821024 TTGTTCTTGTTCCCATTCTTTGG - Intronic
977390656 4:96405566-96405588 TTGCCCAGGGTCACATTGTTGGG + Intergenic
978489380 4:109295735-109295757 TTGCCTATGTTCTCATTTTTGGG - Intronic
980677108 4:136099633-136099655 TTTACCATGTTCATATTAATAGG + Intergenic
981516467 4:145615369-145615391 TTTACCTTGTTCCCAATCTTAGG + Intergenic
981681090 4:147398803-147398825 TGGCCCACGTTCACATTCTTTGG + Intergenic
984074324 4:175155966-175155988 CTTACCTTGTTCACTTTCTTAGG + Intergenic
984483865 4:180340866-180340888 TTGACCATGATAATATTCTATGG - Intergenic
986121563 5:4842297-4842319 TTGAGCATATTCACATACTCTGG - Intergenic
987261581 5:16209699-16209721 GTGGCCATGTTCACATATTTTGG + Intergenic
988942478 5:36160137-36160159 TTGCCCAAGTTCACAGACTTGGG + Intronic
988947944 5:36225373-36225395 TTGACCATGTTCACATTCTTGGG - Intronic
990387658 5:55282893-55282915 TTGAGTTTGTCCACATTCTTTGG + Intronic
991237234 5:64413093-64413115 TTGATCATGTTCACATTTATTGG - Intergenic
991523423 5:67528033-67528055 TTGACCATGTGACCTTTCTTTGG + Intergenic
994057661 5:95436994-95437016 TTGGCCAGGTTCAAATTCCTGGG - Intronic
994540431 5:101089243-101089265 TTTACCATTTTAACGTTCTTTGG - Intergenic
996104614 5:119485066-119485088 TTGGCAATGTTCCAATTCTTGGG - Intronic
996180787 5:120417297-120417319 TTGTCCATTTTCAAATTCCTTGG + Intergenic
996442315 5:123506004-123506026 TTGACCCTGTTTAACTTCTTTGG - Intergenic
998027310 5:138829528-138829550 TTGAGGTTGGTCACATTCTTGGG + Intronic
998799390 5:145853844-145853866 TTGACCATGTCTGCTTTCTTAGG - Intergenic
1000451271 5:161390906-161390928 TTAACCATGTGCATCTTCTTAGG + Intronic
1000675244 5:164113927-164113949 TTAATCATGTTCACCATCTTCGG - Intergenic
1001477800 5:172063527-172063549 TTGAAGATGTACACATCCTTTGG - Intronic
1002102098 5:176862701-176862723 TTGACGATGTACACATCCTCGGG - Exonic
1003783990 6:9462774-9462796 TTGACCATTTGCATATTTTTTGG - Intergenic
1004101217 6:12613784-12613806 TTGAAAATGTTCACATTCGCTGG - Intergenic
1005706202 6:28456032-28456054 TTCTACATGTTCACATTGTTGGG - Intergenic
1006532367 6:34667180-34667202 TTCACTATGTTTACATTATTTGG - Intronic
1008077598 6:47161657-47161679 TTGACAATGTTCTCATTCTTGGG - Intergenic
1009293017 6:61908231-61908253 TTGTCCTTATTCACATACTTAGG - Intronic
1009801646 6:68545467-68545489 TTGATCTTGTTCACAGCCTTAGG - Intergenic
1010451890 6:76012999-76013021 TTCACCATGTTCTCATTCACAGG + Intronic
1010883312 6:81206761-81206783 TTGAGCATTTTCATTTTCTTTGG - Intergenic
1011077592 6:83454017-83454039 TTGTGTAAGTTCACATTCTTGGG - Intergenic
1012631778 6:101478854-101478876 TCCACCATCTTTACATTCTTTGG + Intronic
1014610976 6:123546091-123546113 TTGACTATGTTCACTCTCTATGG + Intronic
1015080663 6:129222116-129222138 TTGCTCATGTTCAACTTCTTGGG + Intronic
1016262820 6:142193692-142193714 TTGAGCAAATTAACATTCTTTGG + Intronic
1016583847 6:145661429-145661451 TTAAACAAGTTCACATTCTCAGG - Intronic
1018467022 6:164057435-164057457 TTGATGATGGTCACTTTCTTGGG + Intergenic
1021053850 7:16022259-16022281 TTTACCATGTTCATATTTTGAGG - Intergenic
1022847340 7:34223513-34223535 TTGATCTTGTTCCAATTCTTTGG + Intergenic
1022900520 7:34804600-34804622 TTTACCTTGTTCCCAGTCTTAGG - Intronic
1023117729 7:36878700-36878722 TTGTGCATGTCCCCATTCTTTGG - Intronic
1023137879 7:37071368-37071390 TTCACCATGCCCACAATCTTAGG + Intronic
1023627331 7:42129269-42129291 TTGCCCATAATCACATTGTTAGG + Intronic
1024184346 7:46934275-46934297 TTGCCCTTGCTCACTTTCTTGGG + Intergenic
1024781206 7:52851530-52851552 TTCACCTTGTTCCCAATCTTAGG - Intergenic
1026942531 7:74295566-74295588 TTGCTCATGTTCAGCTTCTTTGG + Intronic
1029919036 7:104242827-104242849 TTCATCATTTTCACATTCTGGGG + Intergenic
1029991657 7:104967840-104967862 CTGACCATTCTCACATTCCTGGG - Intergenic
1030184384 7:106746441-106746463 TTTATCAGGTTCACATTCCTTGG - Intergenic
1030435679 7:109516717-109516739 TTTAGTATGTTCACATACTTCGG + Intergenic
1032892520 7:136213825-136213847 TAAACCATCTTGACATTCTTAGG + Intergenic
1033307155 7:140233133-140233155 TTGTCATTCTTCACATTCTTAGG - Intergenic
1033867466 7:145709777-145709799 TATACCATGTTCACATTAATTGG - Intergenic
1038129660 8:24715761-24715783 TTGCCCCTTTTCCCATTCTTTGG - Intergenic
1039277681 8:35951793-35951815 TTGACTATGTCCACATACGTTGG - Intergenic
1041289485 8:56295532-56295554 ATGATGATGGTCACATTCTTGGG + Intergenic
1043304510 8:78777900-78777922 AAGATCAAGTTCACATTCTTCGG + Intronic
1043381241 8:79704386-79704408 TTCACTATGTTGGCATTCTTAGG - Intergenic
1044330138 8:90909513-90909535 TTTAGCATGTTCACAATTTTCGG + Intronic
1046606418 8:116376001-116376023 TTGCCCATGTTCCCCTTCTCTGG + Intergenic
1046828421 8:118717360-118717382 TGGAACATGTTTACATTCTTAGG - Intergenic
1047883336 8:129220291-129220313 TTTACCATGTTAACATTTTAAGG - Intergenic
1050863873 9:10472584-10472606 TTGAGCATCTTCACAATGTTTGG + Intronic
1051555666 9:18379843-18379865 TTTCCCATTTTTACATTCTTGGG + Intergenic
1052118967 9:24685146-24685168 ATGACCATGTTCACTGTCTATGG + Intergenic
1052516885 9:29493055-29493077 TTGGCCATGTTATTATTCTTTGG + Intergenic
1055027972 9:71742616-71742638 GTGACCATTTTGACTTTCTTAGG - Intronic
1056552347 9:87662863-87662885 TTGAGATTTTTCACATTCTTTGG + Intronic
1059687002 9:116647410-116647432 GTGACCACTTTCACACTCTTGGG + Intronic
1061901753 9:133676432-133676454 TTAAGTATGTTCACATTGTTGGG - Intronic
1186096373 X:6107105-6107127 TTGAACACTTTCACATACTTTGG + Intronic
1186585458 X:10868585-10868607 TTGAGCATGTTCACAGCCCTGGG + Intergenic
1186595004 X:10971398-10971420 GTGGGCATTTTCACATTCTTTGG + Intergenic
1187740835 X:22353732-22353754 TTGATGATGTTTCCATTCTTAGG - Intergenic
1188199436 X:27280877-27280899 TTGACCATGCCCACATTCAATGG - Intergenic
1188757456 X:33980170-33980192 TTGACCATGAGAACCTTCTTTGG - Intergenic
1189029410 X:37435174-37435196 TTTAACATGCTCCCATTCTTTGG - Intronic
1190146609 X:47897342-47897364 TTGACCATTTGTACATTTTTTGG + Intronic
1190433026 X:50395699-50395721 TTGACCATCTTCTCATCTTTAGG - Intronic
1191790238 X:64963640-64963662 TTGGCCATGTTTATGTTCTTTGG - Intronic
1193565144 X:83066469-83066491 TAGAGGCTGTTCACATTCTTTGG + Intergenic
1193653644 X:84170803-84170825 TAGGCCATGTTCACATTCAAGGG - Intronic
1194334088 X:92624092-92624114 TTCACCATATTCACTTTCTCAGG - Intergenic
1195591646 X:106635077-106635099 TTGGCCATGCTCCCCTTCTTGGG - Intronic
1195951969 X:110284634-110284656 TTCACCTAGATCACATTCTTTGG - Intronic
1196432613 X:115642975-115642997 TTCACCATCTTCACTTTCTCTGG - Intronic
1196624779 X:117865799-117865821 TTGAACATATTCAAACTCTTTGG - Intergenic
1197955747 X:131945751-131945773 TTGTCCTTGTTCACTTTCTGTGG + Intergenic
1198814437 X:140573047-140573069 TTGATCTTGTGCATATTCTTTGG + Intergenic