ID: 988949379

View in Genome Browser
Species Human (GRCh38)
Location 5:36241800-36241822
Sequence GTGGGCCGGGCCGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 430}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988949370_988949379 7 Left 988949370 5:36241770-36241792 CCCAGCAAGAAGCCTCGGTAGCA 0: 1
1: 0
2: 0
3: 7
4: 60
Right 988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 55
4: 430
988949367_988949379 27 Left 988949367 5:36241750-36241772 CCGCCACGCGACAACAGCTGCCC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 55
4: 430
988949368_988949379 24 Left 988949368 5:36241753-36241775 CCACGCGACAACAGCTGCCCAGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 55
4: 430
988949366_988949379 28 Left 988949366 5:36241749-36241771 CCCGCCACGCGACAACAGCTGCC 0: 1
1: 0
2: 0
3: 3
4: 97
Right 988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 55
4: 430
988949373_988949379 -5 Left 988949373 5:36241782-36241804 CCTCGGTAGCAAGTCATCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 55
4: 430
988949371_988949379 6 Left 988949371 5:36241771-36241793 CCAGCAAGAAGCCTCGGTAGCAA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG 0: 1
1: 0
2: 4
3: 55
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988949379 Original CRISPR GTGGGCCGGGCCGCGGCCGC GGG Intronic
900087228 1:904415-904437 GAGGGCGGGGCCGGGGCCGGCGG - Intergenic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900227564 1:1540227-1540249 GTGGGCCAGGCGGCGCGCGCGGG + Intronic
900243990 1:1629395-1629417 GCGGGCGGGGGCGCGGCCCCGGG + Exonic
900388013 1:2419459-2419481 GAGGCCCGGGCCTCGGCCGTTGG + Intergenic
901373238 1:8817962-8817984 GTGGGCTGGGCTCCCGCCGCGGG + Intergenic
901796294 1:11681272-11681294 GGGGGCCGGGCCTCGGCGTCCGG + Exonic
902323606 1:15684399-15684421 GAGGGCCGGGCGGCGGGCGCCGG + Exonic
902950954 1:19882539-19882561 GCCGGCCGGGCAGCGGCAGCCGG + Exonic
903184761 1:21622656-21622678 GCGGCCCGGCCCGCGGCCCCGGG + Intronic
904199782 1:28812259-28812281 GGCGGCCGGGGCGCGGCAGCCGG + Exonic
904941006 1:34164865-34164887 GTGGGGCGCGCGGCGGCCGCTGG + Intronic
905518397 1:38578770-38578792 TTAGGCAGGGCCGCGGCCCCTGG - Intergenic
905580774 1:39081633-39081655 GGGAGCTGGGGCGCGGCCGCCGG - Intronic
905789782 1:40783938-40783960 AGGGGCCGGGCCGGGGCCGCGGG - Intergenic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906317842 1:44799857-44799879 CTGGGCCGGGCCCCGGGCGAGGG + Intergenic
908355371 1:63322255-63322277 GTGGGCCTGGGAGCGTCCGCGGG - Intergenic
910676437 1:89821144-89821166 GCGGGCGGGGCCGCGGGAGCAGG + Exonic
912305253 1:108560303-108560325 GTGCGCGGGGGCGCGGCCGGGGG - Exonic
912800184 1:112715319-112715341 GGGGGCGGGGCCGCGGCCGAGGG - Exonic
913047858 1:115089307-115089329 GGGGGCCGGGTGGCGGGCGCGGG - Intronic
913205527 1:116534642-116534664 GTGGGCAGCGCCGCCGCGGCGGG - Intronic
913453467 1:119008084-119008106 TTGGGCCGGGCCGGGGCCGCCGG - Intergenic
915288825 1:154869503-154869525 GTGGGCCTGGCGGAGGCAGCCGG - Exonic
915589135 1:156860788-156860810 CGGGGCCGGGCGGGGGCCGCTGG + Intronic
917291599 1:173477224-173477246 GGGGGCCGGGCCGCGGGGGCTGG - Intergenic
918326671 1:183417487-183417509 GGGGGCCGGGCGGAGGCTGCGGG - Intronic
920095554 1:203484167-203484189 GTGGGCCGGGGCGGGGCCGAAGG + Intronic
920260540 1:204685272-204685294 CTGGGCAGCGCCGCCGCCGCCGG - Intronic
921689842 1:218135626-218135648 GTGGGCTTGGCCGCTGCCCCAGG - Intergenic
922200078 1:223393862-223393884 GCGGGCAGGGCTGCGGCCGCTGG - Exonic
922440736 1:225653270-225653292 GGGGGCCCGGCCGCCGGCGCGGG - Intergenic
922730623 1:227947224-227947246 GTGGCCCGGGCCCCGGCCCGCGG - Intronic
924415281 1:243850681-243850703 GCGGGCAGGGCCGGGGACGCGGG - Intronic
1062873878 10:930956-930978 CTGGGCGGGGCCGGGGTCGCGGG - Intronic
1064354414 10:14604352-14604374 GCGGGCCGGGCCGCCGCCCCCGG - Intronic
1065186479 10:23174429-23174451 GTGGGCTGGGCGTCGGCCGCGGG + Intergenic
1065343026 10:24723794-24723816 TGGGGCGGGGCGGCGGCCGCCGG + Intergenic
1066047120 10:31603710-31603732 GTGGGCGGGGCCCCGGGCGACGG - Intergenic
1066370360 10:34814677-34814699 GCGGGCCGGGGCGCAGCCTCTGG - Intronic
1067060942 10:43077569-43077591 GCGGGCCGGGCCGCGGGGGTCGG + Intronic
1067346910 10:45443829-45443851 GTAGGCAGGGCCGGGCCCGCTGG + Intronic
1067405971 10:46023607-46023629 GGGGGCCGGGCGGGGGCAGCAGG - Intronic
1067694119 10:48523403-48523425 GTCGGCCGGGCCCCAGCCCCCGG + Intronic
1069019157 10:63466033-63466055 GCGGGCGGGGCAGCAGCCGCGGG + Intergenic
1072656568 10:97334307-97334329 GGGGGCCGGGCCTTGTCCGCCGG + Exonic
1073147891 10:101292348-101292370 GCAGGCCGGGCGCCGGCCGCTGG - Intergenic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1075032043 10:119030068-119030090 GGGGGCCGGGCCTGGGGCGCTGG + Exonic
1075801854 10:125159420-125159442 GCGGGCCGGGCGGCGGGCGCGGG - Intronic
1076993899 11:289271-289293 GGGGGACGGGCCGGGGCGGCCGG - Intronic
1077076992 11:706417-706439 GGCGGCCGGGCCGAGGGCGCGGG + Intronic
1077124422 11:926109-926131 GGGGCCGGGGCCGGGGCCGCCGG + Intronic
1077413649 11:2414684-2414706 GCGGGCCCGGCCCCAGCCGCCGG + Intronic
1078659800 11:13277741-13277763 GGGGGCCGGGCCTGGGCCGGCGG + Intronic
1079250147 11:18781145-18781167 GGGGGCCGGGGCGGGGCCGGGGG - Intronic
1081710484 11:45212668-45212690 GTGGGCTGGGGTGCGGCCGAGGG - Intronic
1083241621 11:61392796-61392818 GTGGGCGGGACCGCGGAAGCCGG - Intronic
1083262010 11:61528270-61528292 GTGGGCTGGGCCACCGCCTCTGG - Intronic
1083454758 11:62771373-62771395 GAGGGCGGGGCCGGGGCCCCGGG + Exonic
1083842882 11:65314827-65314849 GCGGGCCGGGGCGGGGCTGCGGG + Exonic
1083849165 11:65355194-65355216 GAGGGCAGGGCCGAGGGCGCAGG - Intronic
1083936592 11:65872814-65872836 GTGGGCCGCGCCGCGGCAGGCGG - Exonic
1084146255 11:67266827-67266849 CGGGGTCGGGCCGGGGCCGCGGG - Intronic
1084171280 11:67401983-67402005 GGGGGCGGGGCCTCGGCGGCGGG + Intronic
1084196407 11:67525337-67525359 GTGGGCCGGGCAGCCCCTGCTGG + Intergenic
1084212498 11:67630452-67630474 CAGGGCCGGGCCGTGGCCGGGGG + Intergenic
1084372222 11:68751466-68751488 GTGGGCCGGGCCTCAGGCGCAGG + Exonic
1084758038 11:71251654-71251676 GGCGGCCGGGCTGCGCCCGCCGG + Intronic
1087046849 11:93850160-93850182 GTGGGCCGGGGCGCCGCGGCCGG + Intronic
1092173259 12:6386135-6386157 GTGGGGCTGGCAGCGGGCGCTGG - Exonic
1093435281 12:19129577-19129599 GGCGGCCGGCCGGCGGCCGCCGG + Intergenic
1093958846 12:25251105-25251127 GGGGGCCGGGCCGGGCCGGCGGG + Intergenic
1095810995 12:46372937-46372959 CGGGGCTGGGCCGCGGGCGCGGG - Intergenic
1096154315 12:49333313-49333335 GGCGGCCGGGCAGCCGCCGCAGG + Intronic
1096191642 12:49623648-49623670 GCGGCCCGGGCCGTGGCCGATGG + Intronic
1096284131 12:50283524-50283546 GGGGTCCGGGGCGGGGCCGCAGG - Intronic
1096674381 12:53218780-53218802 GCGGGCGGGGCGGCGGGCGCTGG - Intronic
1096674924 12:53221215-53221237 GCGGCCCGGGCCGCGGCGGAGGG - Intronic
1096796733 12:54082557-54082579 GCGGGCCGGTCCGGGGCCGGGGG + Intergenic
1098161028 12:67648624-67648646 GTGTGCGTGGCCGCGGCCGGGGG + Intronic
1098416805 12:70243598-70243620 GTGGGCCGGGACGCTACCGGCGG - Intronic
1100260652 12:92929334-92929356 GCGGGCCCGCCCGCGGCCGCCGG + Intergenic
1101479652 12:105084599-105084621 GTGGGGCGGGCCGCGGGCTGTGG - Intergenic
1102370857 12:112381791-112381813 GCAGGTGGGGCCGCGGCCGCAGG - Intronic
1102644647 12:114396223-114396245 GGCGGCCGGGCCACGGCGGCCGG - Intronic
1102854016 12:116277699-116277721 GCGGGCCGAGCCGCGGTCGGCGG - Intergenic
1102933775 12:116880935-116880957 GAGAGCCGGGGCGCGGCAGCTGG - Intronic
1103749771 12:123150840-123150862 GCCGGCCGGGCCGGGGCCGCGGG - Intergenic
1103764744 12:123271920-123271942 GAGGCGCGGGGCGCGGCCGCAGG - Exonic
1104049498 12:125186290-125186312 GAGGGCGGGGCCGCGGCCGGGGG - Intergenic
1104409227 12:128544074-128544096 GTGGGCTGGGCCCCAGGCGCTGG - Exonic
1104727701 12:131088019-131088041 GTGGGCCGGGCCCTGGCGGGAGG - Intronic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105034503 12:132908911-132908933 GTGAGCCCGGCGGCTGCCGCCGG + Intronic
1105502938 13:20988525-20988547 GCGGACCGGGCCGCGGCTGGTGG + Exonic
1105881120 13:24607247-24607269 GTTGGCCGGGCTGTGGCAGCTGG + Intergenic
1106109029 13:26760787-26760809 GTGGGCCGGGCGGGCGCGGCGGG - Intergenic
1107467534 13:40664786-40664808 GTGGGAGGGGCCCCGGGCGCAGG - Intronic
1107865203 13:44696417-44696439 GTGGGCTGGGCCGGGGGCGGTGG + Intergenic
1107945939 13:45418054-45418076 TTGGGTCGGGCCGGTGCCGCGGG - Intronic
1108313891 13:49220111-49220133 CCGGGGCGGGCCGCGGCCGTGGG + Intergenic
1108518279 13:51222580-51222602 CCGGGCCGGGCCGCGGGCGGGGG + Intronic
1110318639 13:74135697-74135719 GCGGGCCGGGCCGGGGGCGCGGG - Intergenic
1110450796 13:75636124-75636146 GGGGCCCGGGCCGCGGCCCCTGG + Intronic
1110705943 13:78602183-78602205 GCGGCCCGGGCGGCGGCCCCGGG - Exonic
1111940477 13:94601867-94601889 GTGGGGCGGGCAGCCGCCGGCGG + Intergenic
1112402085 13:99086380-99086402 CCGGGCCGGGCCGCGGGAGCAGG - Intronic
1114270710 14:21098431-21098453 GGGGGCCGGGCCGGGGGCGGGGG - Exonic
1115545461 14:34462049-34462071 GGGGGCCGGGCTGGGGGCGCGGG - Intronic
1115592213 14:34874970-34874992 GTGAGCCTGGCGGCGGCGGCGGG - Intronic
1116820424 14:49621417-49621439 GTGGTCCCCACCGCGGCCGCCGG - Exonic
1116887104 14:50231912-50231934 GCGGGCCGAGCCTCGGCTGCTGG - Intergenic
1117542546 14:56762266-56762288 GTGGGCCGGGGCCCAGCTGCAGG + Intergenic
1117549306 14:56817709-56817731 GTGAGCCAGGGCGCGGCTGCAGG + Intergenic
1117841947 14:59869933-59869955 GCGGGCAGGCCCGCGGCCCCTGG - Intronic
1119003911 14:70907541-70907563 GGGGGCCGGGCCGCGGCTCCGGG + Exonic
1119410282 14:74426091-74426113 GCGGGGCGGGCGGCGGCGGCGGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119701997 14:76761854-76761876 GAGCGGCGGGCTGCGGCCGCGGG - Intergenic
1120167880 14:81220308-81220330 GAGCGCCGGGCGGCGGGCGCGGG - Intronic
1122399711 14:101459293-101459315 GTGGCCCGGGCCGCGCGCTCGGG + Intergenic
1122444589 14:101760450-101760472 GTGGGCGGGGCCGACGCCGGAGG + Intergenic
1122719865 14:103716018-103716040 CGGGGCCGGGCCGGGGCGGCGGG - Intronic
1122789795 14:104179401-104179423 GTGGGCCGGGCTGGGTCCGTGGG - Intronic
1122905772 14:104800812-104800834 GTGGGCCGGGCGGCAGCTGGAGG + Intronic
1122978556 14:105181078-105181100 GTGGGCCGGGCCGCCGGCGGGGG + Intronic
1123035499 14:105470228-105470250 GAGGGGCGGGGGGCGGCCGCAGG - Exonic
1123071432 14:105644348-105644370 GTGGGGCGGGCAGAGGCCTCCGG + Intergenic
1123076390 14:105669403-105669425 GTGGGGCGGGCAGAGGCCTCCGG + Intergenic
1123091095 14:105742629-105742651 GTGGGGCGGGCAGAGGCCTCCGG + Intergenic
1123096862 14:105770964-105770986 GTGGGGCGGGCAGAGGCCTCCGG + Intergenic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1125677589 15:41511220-41511242 CTTGGCTGGGCCGCGGCCGGCGG - Exonic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1128161042 15:65422969-65422991 GCGGGCGGGGGCGCGGCCTCGGG + Exonic
1128743179 15:70097022-70097044 CGGGGCCGGGCGGCGGGCGCGGG + Exonic
1129339049 15:74873132-74873154 GAGGCCCGGGCGGCGGCCGTGGG + Intronic
1129440627 15:75578748-75578770 TCGGGCCGGGGCGCGGTCGCGGG + Exonic
1130908483 15:88255822-88255844 GAGGGCCGGCTCCCGGCCGCGGG + Intronic
1131054605 15:89368135-89368157 GCGGGCCGGGCCGGGGCGGTCGG - Intergenic
1131180258 15:90234238-90234260 GTGGCCCCGGCAGCGGCTGCGGG + Intronic
1131272810 15:90957204-90957226 GCGCGCCGGGCCGGGGCCGGAGG + Exonic
1131398979 15:92109685-92109707 GTGGGCAGGGCTGGGGCCTCAGG + Intronic
1132065543 15:98727855-98727877 GCGGGCCAGGCCGGGGCTGCTGG + Intronic
1132314234 15:100879195-100879217 CTGGGCCGGGGTGCGCCCGCCGG + Intronic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132480574 16:164707-164729 GCGGGGCGGGGCGGGGCCGCGGG + Intronic
1132523498 16:402081-402103 GGGGTCCGGTCCGCGGGCGCCGG + Intronic
1132527850 16:426273-426295 GCGGGCCGGAGCGCGGCGGCGGG - Exonic
1132591169 16:727080-727102 GGAGGCGGGGCCTCGGCCGCCGG - Intronic
1132663476 16:1071593-1071615 GAGGGCCTGGCCATGGCCGCAGG + Intergenic
1132719739 16:1309786-1309808 GGGGGCCGGGCCGGGGCCGCGGG + Intronic
1132756531 16:1487998-1488020 GCGGGCCGGGCCGGGCCGGCTGG + Intronic
1132778910 16:1612454-1612476 GCGGGCCGGCGCGCGGCTGCGGG - Intronic
1132779410 16:1614444-1614466 GTGGGCAGGGCCGGGGGCGGCGG + Intronic
1133032932 16:3020323-3020345 GGGGGCGGGGCGGCGGCCGTGGG + Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1135429943 16:22374467-22374489 GCCGGCCGGTCGGCGGCCGCCGG - Exonic
1136365469 16:29807212-29807234 GGGGGCGCGGCCTCGGCCGCGGG - Exonic
1136779105 16:32885961-32885983 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG + Intergenic
1137707937 16:50548347-50548369 GAGGCGCGGGCCGCGGCGGCGGG + Exonic
1141054530 16:80803721-80803743 GGGGGGCGCGCCGCGGCCGGCGG - Intronic
1141570683 16:84931865-84931887 GTGGGCCTGCACGCTGCCGCTGG + Intergenic
1142156473 16:88534733-88534755 GCGGGCCGGGCGGCGGCTCCTGG - Exonic
1142191581 16:88720632-88720654 GGCGGCCGGGCGGCGGCTGCAGG - Exonic
1142306069 16:89286387-89286409 GTGGGAAGGGCTGCAGCCGCGGG + Intronic
1203081520 16_KI270728v1_random:1148049-1148071 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1142764341 17:2057148-2057170 GTCGGCCGGGCCGGGGCCTGCGG + Exonic
1142810617 17:2393962-2393984 GCGGGGCGGGGCGCGGCCGGGGG + Intronic
1142876385 17:2853896-2853918 GGGGGCCGGGGCGCGGGCTCAGG + Intronic
1143478722 17:7217152-7217174 GGGGGCCTGGCCGCGGCGGCGGG + Exonic
1143524200 17:7462900-7462922 GTGGGCTGCCCCGAGGCCGCCGG - Exonic
1143614165 17:8039613-8039635 GCGGGCCGGGCTGGGGCTGCAGG + Intronic
1144759690 17:17700399-17700421 GGGCGGCGGGGCGCGGCCGCTGG - Intronic
1145846254 17:28041708-28041730 GGGGGCGGGGCCTCGGCGGCTGG + Intergenic
1145919334 17:28598845-28598867 CTGGGCCGGGCTGCTGTCGCGGG - Intronic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146393674 17:32444732-32444754 GGGGGCCGGGCCGGGGGCGCAGG + Intronic
1146393715 17:32444870-32444892 GTGGGCCGAGCCGGGCCCCCGGG + Intronic
1146439054 17:32877321-32877343 CTGGGCCGGGCGGCGGCAGCTGG + Intergenic
1147159459 17:38561919-38561941 CTGAGCCTGGCCGCGGCCGCCGG - Exonic
1147564437 17:41527805-41527827 GTGGGCGGAGGCCCGGCCGCGGG - Intronic
1147742497 17:42676942-42676964 GCGGCCCGGGCCCCGGCCACCGG - Exonic
1147971037 17:44219240-44219262 CTGAGCCGAGCCCCGGCCGCTGG - Intronic
1147994583 17:44353889-44353911 GGGGGCGGGGCCGCAGCCGCGGG - Exonic
1148090920 17:45022102-45022124 CTGGGCCGGGCCTCCGCGGCGGG - Intergenic
1148183145 17:45620798-45620820 GCGAGCCGGGCAGCGGCCGCGGG + Intergenic
1148265705 17:46224893-46224915 GCGAGCCGGGCAACGGCCGCGGG - Intronic
1148566025 17:48633562-48633584 CTGGACTGGGCCGCGGCCGCTGG - Intronic
1150373355 17:64661286-64661308 GTGGCCCGGGCAGCGGTGGCCGG + Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1151569929 17:74921135-74921157 GTGTGCCGGGCCCCAGCCCCGGG + Intronic
1151724896 17:75878130-75878152 GCGGGCAGGGCCGCGCCCTCGGG + Exonic
1151797051 17:76353496-76353518 GAGGGCCGGGCCGGGGGCGGCGG - Intronic
1152406624 17:80101626-80101648 GTGAGCCGGGCCGGGGCTGCGGG + Intergenic
1152581123 17:81166044-81166066 GCGGCTCGGGCCGGGGCCGCGGG - Intronic
1152627330 17:81393692-81393714 GCGGGCCGGGCCGGGGACGCAGG - Intergenic
1152750196 17:82059055-82059077 GTGGGCTGGGGGGCCGCCGCAGG + Intronic
1152808609 17:82370918-82370940 AGGGGCCGGTCCGCGGCCTCAGG + Intergenic
1152809633 17:82375444-82375466 GCAGGTCGGGCCGGGGCCGCTGG - Exonic
1152834335 17:82519762-82519784 GGGGGCCGAGCGGAGGCCGCCGG - Exonic
1153489203 18:5630297-5630319 GTGGGCAGGGGCGCGGGTGCGGG - Intronic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1153900678 18:9614676-9614698 GCGGGGCGGGGCGCGGCCGGGGG - Intronic
1154266477 18:12883553-12883575 GCGAGCCGGGCCGCGGCGTCCGG - Intronic
1155221499 18:23689798-23689820 CTGAGCCCGGCCGCGGCCCCGGG - Exonic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1157384034 18:47247412-47247434 GGGGCAGGGGCCGCGGCCGCCGG - Intronic
1157384233 18:47248084-47248106 GTGGGCGTGGGCGCGGGCGCGGG - Intronic
1160631263 18:80247584-80247606 GCGGGGCGGGGCGCGGGCGCGGG - Intergenic
1160680342 19:409221-409243 GGGGGCGGGGGCGCGGGCGCGGG - Intergenic
1160736087 19:663022-663044 GAGGCCCGGGCCGGGGCGGCGGG - Intronic
1160766813 19:812525-812547 GGGGGGCGGGCCGAGGGCGCGGG - Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160858917 19:1229462-1229484 GCGGGTCGGGCCGCGCCGGCAGG + Exonic
1160875845 19:1295894-1295916 GTGGGCGGGGACGCGGGGGCGGG + Intronic
1160909399 19:1467856-1467878 GTTGGCGTGGGCGCGGCCGCCGG - Exonic
1160930714 19:1568357-1568379 CGGGGCCGGGGCGGGGCCGCGGG - Intergenic
1160935484 19:1592661-1592683 GGGGTCCGGGCGGCGGCGGCGGG - Exonic
1161215777 19:3094511-3094533 GCGGGCCGGCCCGGGGCCGAGGG + Exonic
1161215821 19:3094599-3094621 GGGGGCCGGGGGGCGGCGGCGGG + Exonic
1161219978 19:3113985-3114007 GGTGGCCGGGCCATGGCCGCAGG + Intronic
1161495614 19:4584363-4584385 GCGGCCCGGGCTGCGGCCCCGGG + Intergenic
1161648214 19:5467472-5467494 GTGGGCCAGGCTGCTGCTGCGGG + Intergenic
1161855245 19:6760837-6760859 GTCGGCCTGGCCGGGGACGCAGG + Exonic
1161925133 19:7294133-7294155 GGGGCCCGGGCCGCAGCGGCCGG - Intergenic
1162013184 19:7830279-7830301 GGGGGCCGGGCCGGGGCTGCGGG + Intronic
1162687653 19:12400918-12400940 GTAGGTCGGCCCTCGGCCGCAGG - Intronic
1162691975 19:12440762-12440784 GTAGGTCGGCCCTCGGCCGCAGG - Intronic
1162907073 19:13830470-13830492 GTGGGCGTGGCCCAGGCCGCCGG - Exonic
1162914218 19:13865572-13865594 GAGGGCCGGGCCGCAGAGGCCGG - Intronic
1162940397 19:14005904-14005926 GGGGGCCGGGCCGCGGGGACGGG + Intronic
1163123829 19:15233436-15233458 CGGCGCCGGGCCGAGGCCGCTGG - Intergenic
1163523762 19:17807937-17807959 GTGGGCCAGGCCAGGGCCTCGGG - Exonic
1163627296 19:18397509-18397531 GTGGGCCAGGACGCAGCCTCTGG - Exonic
1164155746 19:22596038-22596060 GCGGGCGGGGGCGGGGCCGCAGG - Intergenic
1164639006 19:29811639-29811661 GAGGGGCGGGCCGCGGGCGCCGG - Intergenic
1165349830 19:35269387-35269409 GGGGGCGGGGGCGCGGGCGCGGG + Intronic
1165892994 19:39125951-39125973 GTGGGCCGGGCGCTGGCGGCGGG + Intronic
1166194835 19:41198732-41198754 GGGGGCCTGGCAGGGGCCGCAGG - Exonic
1166340167 19:42132560-42132582 GTGGGCCGGGCTGCCGGGGCGGG - Intronic
1166518360 19:43463570-43463592 GGGGGCCGGGCCGTAGCTGCGGG - Intronic
1166524968 19:43504911-43504933 TGGGGCCGGGCCGGGGCCGGTGG - Exonic
1166790681 19:45396761-45396783 GCGGGCCTGGCCCGGGCCGCGGG + Exonic
1166803676 19:45472679-45472701 GGGGCCCGGGCCGGGCCCGCTGG + Exonic
1167311250 19:48739139-48739161 CTGGGCCGGCCCGCGGCGGCGGG - Exonic
1168459081 19:56538849-56538871 GAGGGGCGGGGCGCGGCCGGGGG + Intergenic
925607470 2:5673488-5673510 GTGGGGCGGGGCGTGGGCGCTGG - Intergenic
927181140 2:20447441-20447463 GCGGGCCGGGCCCGGGCAGCAGG - Exonic
927751458 2:25673717-25673739 GGTGGGCGGGGCGCGGCCGCGGG - Intergenic
929756354 2:44768676-44768698 GGGCTCCGGGACGCGGCCGCCGG + Intronic
929874036 2:45781634-45781656 GGGGGCCGGGGGGCGGGCGCGGG - Intronic
930020710 2:47000519-47000541 GTGGGCCTGGCCTGGGTCGCTGG + Intronic
930701087 2:54457683-54457705 TGGGGCCGGGCGGGGGCCGCAGG - Intronic
931321460 2:61177654-61177676 GAGGGCCGGGCCGCGGGAGCCGG + Exonic
931671590 2:64653421-64653443 GGGGCCCGGACCGGGGCCGCGGG + Intronic
931671763 2:64653992-64654014 GCGGGCCGGGGCGGGGCCGGCGG - Intronic
932725758 2:74178633-74178655 TGGGGTCGGGCCGCGGGCGCCGG - Intronic
933870657 2:86562871-86562893 GCGGGCCGGGTCGCGTCTGCCGG - Intronic
934079040 2:88452261-88452283 AAGGGCCCGGCCGCGGCCCCGGG + Exonic
934113798 2:88765529-88765551 GTGGGCCCGGCGGCGGCACCAGG + Intergenic
934521902 2:95025190-95025212 ATGGGACCGGCCGCGGCCGCCGG - Intergenic
935149135 2:100417727-100417749 GTGGGGAGGGGCGCGGCCGCGGG + Intergenic
937261148 2:120587417-120587439 GCGGGCCGGGCCGGGGCAGGGGG - Intergenic
938035064 2:128028268-128028290 GAGCGCCGGGGCGGGGCCGCAGG + Intergenic
938073041 2:128318408-128318430 GTCGGGCGGCGCGCGGCCGCCGG + Exonic
938296573 2:130182730-130182752 GTGGGCAGAGACACGGCCGCAGG - Exonic
938460175 2:131491899-131491921 GTGGGCAGAGACACGGCCGCAGG + Exonic
940774965 2:157875944-157875966 CTGGGCCGGCCCTCGGCCCCCGG - Intergenic
941666364 2:168247296-168247318 GGGGCCGGGGCCGGGGCCGCGGG + Exonic
941808705 2:169734406-169734428 GTGGGCCGGGGCCCAGGCGCGGG + Intronic
942890530 2:180981153-180981175 GAGGGCCGCGCGGGGGCCGCGGG - Intronic
946239466 2:218344987-218345009 GTGGGCTGGGCTGGGGGCGCTGG - Exonic
946404061 2:219483526-219483548 CCGGGCCGGGCCGCGGGAGCTGG + Exonic
947611985 2:231530316-231530338 GTGGGCTAGGGCGCGGCAGCTGG - Intronic
947669342 2:231926502-231926524 GAGGGCCGGGAGGGGGCCGCGGG + Intergenic
947724159 2:232387211-232387233 CTGGGCCCGGTCGCGGCCGGCGG - Intergenic
947741336 2:232486379-232486401 CTGGGCCCGGTCGCGGCCGGCGG - Exonic
947774559 2:232697446-232697468 GCGGCCCGGGACGCGGCGGCGGG - Intronic
947860471 2:233354428-233354450 GCGGGCCGGGCCGGGGGCGGTGG - Intergenic
948438057 2:237967197-237967219 GCGGGCCGGGCGGAGGGCGCGGG + Intronic
948983608 2:241507618-241507640 GCGGCCCAGGCCGAGGCCGCAGG + Intronic
949004291 2:241636828-241636850 GGGCGCCGGGCCTCGGCGGCCGG - Intronic
1168991981 20:2102969-2102991 ATGGCCCGGGCCGCCGCCGCCGG - Exonic
1169065485 20:2692623-2692645 CGGGCCCGGGCCGCGGCGGCGGG - Intergenic
1170578421 20:17681402-17681424 ACGGGGCGGGCCGGGGCCGCAGG - Intronic
1170630021 20:18057766-18057788 CTGGGCCGCGCCGCGGCGGGGGG - Exonic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1170999043 20:21395966-21395988 GCGGCCCTGGACGCGGCCGCCGG - Exonic
1171011894 20:21513519-21513541 GAGGGCCGGGCCGCTGGGGCAGG - Exonic
1171452972 20:25248607-25248629 CTGCGCAGGGCCGCGGCCACGGG + Intronic
1172015426 20:31870255-31870277 CAGCGCCGGGCCGCGGCGGCCGG + Intronic
1172618629 20:36306207-36306229 GCGGATCGGGCCGCGGGCGCGGG - Intergenic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1174317498 20:49713854-49713876 GTGGCCCGGCCCGCGACGGCCGG - Exonic
1175215288 20:57389305-57389327 GGGGGCCGGGCCCAGGCGGCAGG - Intergenic
1175220836 20:57415454-57415476 GTGGGCCGGGCTGTGGGCGGAGG - Intergenic
1175831096 20:61965873-61965895 GGGGGCAGGGCCGAGGCGGCAGG - Intronic
1175847334 20:62065644-62065666 GAGGTGCGGGCCGCGGCCGCCGG - Exonic
1175992436 20:62796506-62796528 CTCGGCCGGGCCGCGGCCATGGG + Exonic
1176207217 20:63895494-63895516 CTGGGCCGGGGCGGGGGCGCGGG + Intronic
1176243295 20:64084871-64084893 GGGGGCTGGGCCTCGGCTGCAGG - Intronic
1176311716 21:5154267-5154289 GTGGGACGGGGCGGGGACGCGGG - Intronic
1179444225 21:41420280-41420302 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1179529918 21:42011066-42011088 GACGCCCTGGCCGCGGCCGCCGG - Intergenic
1179641706 21:42752022-42752044 GTGGGCCGGGCCGGGTGCGGTGG - Intronic
1179810552 21:43866389-43866411 GTGGGGCGGGCGGCGGGCCCAGG + Intronic
1179833432 21:44012465-44012487 GGGGGCCGGGCCGGTGACGCCGG + Exonic
1179845334 21:44107768-44107790 GTGGGACGGGGCGGGGACGCGGG + Intronic
1179929623 21:44558593-44558615 GGGGGCCGGGGCGCAGCAGCTGG + Exonic
1179931505 21:44573889-44573911 GGGGGCCGGGGCGCAGCAGCTGG - Exonic
1179939183 21:44627272-44627294 GGGGGCCGGGGCGCAGCAGCTGG - Exonic
1179942030 21:44646559-44646581 GGGGGCCGGGGCGCAGCAGCTGG - Exonic
1180042596 21:45287894-45287916 CCGGGGCGGGGCGCGGCCGCCGG - Exonic
1180167083 21:46035887-46035909 GTGGGCAGGGCTGCGGCTCCCGG - Intergenic
1180733710 22:18000874-18000896 GAGGGCCAGGCCGCGGAGGCAGG + Intronic
1180908366 22:19431576-19431598 GCGGGGCGGGCGGCGGCCGGAGG - Exonic
1180940301 22:19656512-19656534 GGGAGCCGGGCTGAGGCCGCGGG - Intergenic
1181026621 22:20131144-20131166 GTGGACCGGGCCGGGGCCGACGG - Intronic
1181567915 22:23751005-23751027 CTGGGCCGGGGCGGGGCCGCAGG + Exonic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1182254756 22:29030606-29030628 GTGGGGAGGGGCGCGGCCGGTGG + Intronic
1182260958 22:29072993-29073015 GCGGGCCGGGGCGGGGCGGCCGG + Intergenic
1182422624 22:30256019-30256041 GCTGGCGGGGCCGTGGCCGCAGG - Intergenic
1182424916 22:30266811-30266833 GTGCTCCGGCCCGCGCCCGCTGG + Exonic
1183393731 22:37560372-37560394 GGGGGCCGGGCCCCGCCCGCGGG + Intergenic
1183903239 22:41021813-41021835 GGGGGCTGGGCGGGGGCCGCAGG + Intergenic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184099581 22:42335098-42335120 GTGGGCAGGGCCCCGGGAGCAGG - Intronic
1184677910 22:46053664-46053686 GGGGGCCGGGGGCCGGCCGCCGG + Intronic
1184796948 22:46738225-46738247 GTGGCCCGGGCGGCGGGCGGCGG + Exonic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185184641 22:49391686-49391708 GAGGGCTGGGCGGCGTCCGCGGG - Intergenic
1185329404 22:50245430-50245452 GGGGTCCGGATCGCGGCCGCGGG + Exonic
950759262 3:15206235-15206257 GTGGGCGGGGCGAGGGCCGCTGG + Exonic
951962972 3:28349150-28349172 GCGGGACGGGGCGGGGCCGCGGG + Exonic
952816477 3:37452058-37452080 GCGGCCCGGGCGGCGGCGGCTGG - Intergenic
952942284 3:38454057-38454079 GGGGGCCGGGGGGCGGCGGCGGG - Exonic
953925434 3:46980199-46980221 GTGGCCTGGGCCGAGGCGGCCGG + Intronic
954632916 3:52056608-52056630 GGGGGCGGGGCCGCGGGGGCCGG + Intergenic
954733466 3:52685587-52685609 GTTGGGCGGGGCGCGGCGGCTGG - Intronic
958779424 3:98522984-98523006 CCGGGCCGGGCCGCGGCCCGGGG + Intronic
958814673 3:98901952-98901974 CCGGGCCGGGCGGGGGCCGCGGG - Intergenic
963038435 3:141051596-141051618 ACGGGCCGCGCCTCGGCCGCTGG - Exonic
963091396 3:141486926-141486948 GGGGGCGGGGCCGCGGCGGGCGG + Intergenic
966592241 3:181695879-181695901 GTCGGCCCCGCCGCGGCCCCAGG + Intergenic
966746585 3:183282874-183282896 GTGGGCAGGGCTGCAGCCTCTGG + Intronic
966808753 3:183825619-183825641 GCGGGGCGGGCCGCGGGGGCGGG - Intergenic
966878356 3:184336152-184336174 GGGAGTCGGGCTGCGGCCGCCGG + Intronic
966911396 3:184562178-184562200 CCGGGCCGGGCCGCGCCGGCGGG - Exonic
968186951 3:196639615-196639637 GTGGGGCGGGCCGGGGGAGCGGG - Intergenic
968479163 4:826221-826243 AGGGGCGGGGCCGCGGGCGCCGG + Intergenic
968522330 4:1039626-1039648 GGGTGCTGGGCCGGGGCCGCAGG + Intergenic
968583415 4:1405171-1405193 CCGGGCTGGGCCGCGGCCACCGG - Intronic
968659957 4:1794767-1794789 GTGGGCCGGGCCGAGAGCTCCGG + Intronic
968879770 4:3292977-3292999 GAGGGCGGGGCCGAGGCCGGAGG - Intergenic
968965118 4:3765831-3765853 GCGGGGCGGGCCGCGGGCCCTGG - Intergenic
968968261 4:3780522-3780544 GGGGGCTGGGCCGAGGCCTCTGG - Intergenic
969288254 4:6221948-6221970 GTGGGCGGGGCCGAGGCTCCGGG - Intergenic
969330764 4:6472427-6472449 GGTGGGCGGGCGGCGGCCGCGGG + Intronic
969379167 4:6782954-6782976 GGAGGCCGGGCCGCAGCCGAAGG + Intronic
969734125 4:8975570-8975592 GGGGCCCTGGCCGAGGCCGCTGG + Intergenic
970195218 4:13544928-13544950 GTAGCCGCGGCCGCGGCCGCTGG + Exonic
972453701 4:39231022-39231044 GTGGGCTGGGCCGGGGACGGTGG + Intronic
973894183 4:55395932-55395954 CTGGGCCGCGCCGAGGCAGCTGG + Intergenic
977689906 4:99894523-99894545 GAGGGGAGGGGCGCGGCCGCCGG - Intergenic
982460935 4:155667730-155667752 GCGGGGCGCGCCGGGGCCGCTGG + Intronic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
983398495 4:167233915-167233937 GAGGCGGGGGCCGCGGCCGCCGG - Intronic
983919812 4:173333832-173333854 GTGCGCCGGGGCGCGGGCGGGGG - Intronic
985678955 5:1246134-1246156 GTGGGCGGGGCCCCGCCCACAGG + Exonic
985995878 5:3596520-3596542 GTGGCCGAGGCCGCGGCCCCCGG + Intronic
986330819 5:6714640-6714662 GGGTGCCGGGCCGCGGCGCCTGG - Exonic
986402801 5:7396090-7396112 GGGGGCCGGGCGGCGGCCTCGGG - Intergenic
986733283 5:10650145-10650167 TGGGGCCGGGGCGGGGCCGCAGG + Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
991707237 5:69369627-69369649 GTGGGCCGCGGCTGGGCCGCCGG - Intronic
996404191 5:123090218-123090240 GAGAGGCGGGCCGCGGGCGCAGG - Exonic
996948164 5:129094697-129094719 GGAGGCGGGGCCGCGGCAGCCGG + Intergenic
997635082 5:135398937-135398959 GCGGGCCGGGCTCGGGCCGCCGG - Intronic
997704111 5:135930633-135930655 GGCGGCCGGGCCCGGGCCGCGGG - Intronic
998366655 5:141636832-141636854 GAGGGGCTGGCGGCGGCCGCGGG - Exonic
998583485 5:143403750-143403772 AGGGGCCGCGCGGCGGCCGCGGG + Intronic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
999300353 5:150486549-150486571 GTCGGCCGGGCCCCGCGCGCGGG + Intronic
1001482212 5:172096240-172096262 GTGGGCCGGGGTGAGGCAGCAGG - Intronic
1002133186 5:177093568-177093590 GGGGGCAGGGACGCGGGCGCCGG + Intronic
1002532839 5:179858928-179858950 AGGGGCGGGGCCGCGGCGGCCGG - Intronic
1003290634 6:4776164-4776186 GGGGGCGGGGCCGCGAGCGCGGG - Intronic
1004650166 6:17600548-17600570 GTGGGCCGGCCCGGGGCCTGGGG - Exonic
1005957021 6:30671371-30671393 TGGGGCCGGGCCGCGGGGGCAGG - Intronic
1006180390 6:32150525-32150547 GGGGGCGGGGCGGCGGCAGCGGG + Exonic
1006300731 6:33192505-33192527 GGGGGCCGGGCCGGGGGCGGGGG - Intergenic
1006814324 6:36840050-36840072 AGGGGCCGGGGCGGGGCCGCGGG + Intergenic
1007431730 6:41780663-41780685 GAGGGGCGGGCGGGGGCCGCTGG + Intronic
1007473566 6:42105453-42105475 GTGGGCTGGGCCGAGGCAGGAGG + Exonic
1007614398 6:43171739-43171761 GGCGGCCGGGCGGCGGCGGCGGG + Exonic
1007775733 6:44223492-44223514 GGGGGCGGGGCCGCGGGCGTCGG + Intronic
1008511970 6:52284533-52284555 CCCGGCCGGGCCGCGTCCGCAGG + Intronic
1013619376 6:111873140-111873162 CTGGCGCGGGCGGCGGCCGCCGG + Exonic
1016965771 6:149717781-149717803 GTTGGCGGGGCGGTGGCCGCCGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017324508 6:153130730-153130752 GAGGGCCGGGCCAGGGGCGCGGG - Intronic
1017778737 6:157699942-157699964 GTGGGCCAGGCAGCGGCAGCGGG + Intergenic
1017793650 6:157823108-157823130 GGAGGCCGGGCCGCGGCCGAGGG + Intronic
1018091368 6:160348790-160348812 TTGTGCCGTGCCGCGGCGGCTGG + Exonic
1018727809 6:166627189-166627211 GTGGCCCCGGCCGCGGTGGCCGG - Intronic
1018769364 6:166957472-166957494 GTGGGCGGGGCCGCGGGTGCAGG - Intergenic
1018927501 6:168216779-168216801 GTGGGCCAGGACGCAGCCTCGGG + Intergenic
1019111936 6:169724033-169724055 GGGGGCGGGGCCGGGGCGGCGGG - Exonic
1019198431 6:170295855-170295877 GCGGGCCTGGCCTCGGCCCCGGG - Intronic
1019349885 7:549739-549761 GGAGCCAGGGCCGCGGCCGCAGG - Exonic
1019416182 7:927498-927520 CTGGGCCTGGCTGCGGCCTCAGG - Intronic
1019544988 7:1569907-1569929 GGGTCCCGGGCCGCGGCTGCAGG - Exonic
1019739456 7:2665506-2665528 GTGGGCGGGGCCACGCTCGCTGG + Intergenic
1019828407 7:3301813-3301835 TGGGGCCGGGCCGCCGCGGCTGG + Exonic
1020007985 7:4792368-4792390 GGGGGCGGGGCCGAGGCCGGAGG - Intronic
1020418226 7:7969495-7969517 GTGGGCTGCGCCCCGGCTGCGGG + Exonic
1022101674 7:27173008-27173030 GTGGGCCGCGCCGCGCAGGCTGG + Intronic
1022105322 7:27192623-27192645 GTGCGCCGGGTCCCGGCCTCGGG + Intergenic
1022285906 7:28956321-28956343 TGGGGCCGGGCTGCCGCCGCTGG - Exonic
1023015656 7:35967546-35967568 GGGCGCCTGGGCGCGGCCGCCGG - Intergenic
1023838550 7:44082529-44082551 GTGGGCGGGCGGGCGGCCGCCGG + Intronic
1024065280 7:45727141-45727163 GGGCGCCCGGGCGCGGCCGCCGG + Intergenic
1024262397 7:47582146-47582168 GGGGGCCCTGCCGCGGGCGCCGG - Intronic
1024578305 7:50782393-50782415 GTGGGCTCCGCCGCGGGCGCTGG - Intronic
1024580023 7:50793574-50793596 GCGGTCCGGGCGGCGGCGGCGGG - Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1031043548 7:116862917-116862939 GCGGGCGGGGGCGCGGGCGCGGG + Intronic
1031966590 7:128031782-128031804 GGGGGCCGGGCAGCGGCGGGCGG - Intronic
1032011794 7:128351980-128352002 CTGGGGCGGGCGGCGGCGGCGGG - Exonic
1033227860 7:139575163-139575185 GGGGGCCCGGCCGCTGCTGCCGG + Exonic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034228034 7:149497859-149497881 GCGGGGCGGGGCGGGGCCGCGGG - Intergenic
1034347678 7:150397271-150397293 GGGGCCCGGGCCGCGGTCTCCGG + Exonic
1034440542 7:151083523-151083545 ATGCCCCGGGCCGCGGCGGCGGG - Intronic
1034448115 7:151123661-151123683 GTGGGTCGGGCCGGGGCGGCGGG - Intronic
1035156878 7:156921404-156921426 GTGGGCCGGGCCTCGAGTGCTGG - Intergenic
1036432330 8:8702389-8702411 GCGGGCCGGGATGCGGACGCCGG + Exonic
1036664608 8:10730515-10730537 AGGGGCCGGGTCGCGGCTGCGGG - Intronic
1037450645 8:19013532-19013554 CGGGGCCGGGGCGCGGGCGCGGG - Intronic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1038304173 8:26383656-26383678 GCGGGGCGGGCGGCTGCCGCGGG + Intronic
1042271578 8:66961654-66961676 GCGGACCGGGCCGGGGCCGGCGG - Exonic
1043463707 8:80486040-80486062 GGGGGCGGGGGTGCGGCCGCGGG - Intronic
1044306534 8:90646149-90646171 GGGGGCGGGGCCGCGGGCGATGG + Intronic
1045098989 8:98825994-98826016 GTGGGCGGGGCCGGGGACGAAGG + Intronic
1045847881 8:106658316-106658338 GTGGCCGGGGTGGCGGCCGCCGG + Intronic
1048472060 8:134712730-134712752 GTGCGCCGGCCGCCGGCCGCCGG - Intronic
1049229109 8:141472994-141473016 GTGGGCGGGGCCTGGGCCGAGGG - Intergenic
1049531944 8:143159425-143159447 GAGGGCCGGGCTGGGGTCGCAGG + Intronic
1049628233 8:143636242-143636264 GAGGGCCGGGCGGGGTCCGCAGG + Intronic
1049682835 8:143927348-143927370 GTGGTCAGAGCCGTGGCCGCAGG + Intronic
1050091299 9:2017673-2017695 GGGGGCCGGGCCGCGGGCTGTGG + Intronic
1050151556 9:2622781-2622803 GTGCGCCAGCTCGCGGCCGCCGG - Intronic
1050552242 9:6758374-6758396 GAGCGGCCGGCCGCGGCCGCAGG + Intronic
1051174010 9:14346111-14346133 GGGGGGCGCGCCGCGGGCGCGGG + Intronic
1053372724 9:37576234-37576256 GGAGTCCGGGCCGCGGCCGCCGG + Exonic
1054731415 9:68705587-68705609 GCGGGCGGGGCCGGGGCCGGGGG - Intronic
1057331702 9:94121042-94121064 GTGGGCCTGCCCGAGGCCACGGG + Intergenic
1057781919 9:98056981-98057003 GAGGGGCGGGGCGGGGCCGCGGG + Intronic
1058990989 9:110255662-110255684 GAGGTCCGGGCCGCGCCCACGGG - Intronic
1060034071 9:120240097-120240119 GTGGGCCAGGCCAGGGCTGCTGG + Intergenic
1060139891 9:121201253-121201275 CGGGGGCGGGCTGCGGCCGCGGG + Intronic
1060209091 9:121699464-121699486 GGGGACCGGGCGGCGGCGGCGGG - Intronic
1060468760 9:123930229-123930251 GGGGGCGGGGCCGTGGCCGGTGG + Intergenic
1060552301 9:124491403-124491425 GTGGGCCCGGCAGCGTCCCCGGG - Intronic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1061237804 9:129352365-129352387 GTGGACCGGGCCGTGGGGGCGGG + Intergenic
1061275928 9:129569272-129569294 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1062148806 9:135007038-135007060 GAGGGCCGGGCGGGGGCAGCCGG - Intergenic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062615854 9:137395361-137395383 CAGGGCCGGGCCGAGGACGCTGG + Exonic
1062659147 9:137619209-137619231 CGAGGCCGGGCCGAGGCCGCCGG + Intronic
1062659172 9:137619274-137619296 GCGGGCCGGGCGGCGGCTGGGGG + Intronic
1185469413 X:373712-373734 CAGGGCCGGGCCGGGGCCGGCGG + Intronic
1186486707 X:9939214-9939236 GTGGCCAGGGACACGGCCGCAGG - Exonic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1190267315 X:48835269-48835291 GTGGCCCGGGCTCCGGCCGCCGG - Intronic
1192260820 X:69505036-69505058 GCGGGCCGGGCGGCGGCGCCCGG + Intergenic
1193085856 X:77447614-77447636 GCGGGCCGAGCCGGGGCCACGGG - Intergenic
1198302424 X:135344942-135344964 GTGCCCCGGGCGGCGGGCGCCGG + Intronic
1200058752 X:153474725-153474747 GGGGGCGGGGGCGCGGGCGCTGG + Intronic
1200059842 X:153479349-153479371 GTGGGCTGGGCAGCAGCTGCAGG - Intronic
1200098217 X:153673963-153673985 GTGGGCTGGGCGGTGGCGGCCGG - Exonic