ID: 988954789

View in Genome Browser
Species Human (GRCh38)
Location 5:36304471-36304493
Sequence ATATATCAGCTACAGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988954784_988954789 27 Left 988954784 5:36304421-36304443 CCAGCATGGCAGAAAGCAGCACG No data
Right 988954789 5:36304471-36304493 ATATATCAGCTACAGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988954789 Original CRISPR ATATATCAGCTACAGTGGGA TGG Intergenic
No off target data available for this crispr