ID: 988961414

View in Genome Browser
Species Human (GRCh38)
Location 5:36375097-36375119
Sequence GCTGATGGGGAAGCAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988961401_988961414 24 Left 988961401 5:36375050-36375072 CCAGTACCAGAATCTGGTCCAAA No data
Right 988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG No data
988961402_988961414 18 Left 988961402 5:36375056-36375078 CCAGAATCTGGTCCAAAGACAAA No data
Right 988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG No data
988961405_988961414 6 Left 988961405 5:36375068-36375090 CCAAAGACAAAAGGACACGGATG No data
Right 988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988961414 Original CRISPR GCTGATGGGGAAGCAGGAGA GGG Intergenic
No off target data available for this crispr