ID: 988962221

View in Genome Browser
Species Human (GRCh38)
Location 5:36381648-36381670
Sequence TTATGTTTCTTACAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988962217_988962221 10 Left 988962217 5:36381615-36381637 CCCTCTGTGCCTCTAATATCTTT No data
Right 988962221 5:36381648-36381670 TTATGTTTCTTACAGGCTGCTGG No data
988962218_988962221 9 Left 988962218 5:36381616-36381638 CCTCTGTGCCTCTAATATCTTTC No data
Right 988962221 5:36381648-36381670 TTATGTTTCTTACAGGCTGCTGG No data
988962219_988962221 1 Left 988962219 5:36381624-36381646 CCTCTAATATCTTTCTTTTAACT No data
Right 988962221 5:36381648-36381670 TTATGTTTCTTACAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988962221 Original CRISPR TTATGTTTCTTACAGGCTGC TGG Intergenic
No off target data available for this crispr