ID: 988963075

View in Genome Browser
Species Human (GRCh38)
Location 5:36388896-36388918
Sequence CTGCTATTTGCTTGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988963067_988963075 6 Left 988963067 5:36388867-36388889 CCAAGGCTCAGACCATTTCCACT No data
Right 988963075 5:36388896-36388918 CTGCTATTTGCTTGGAAGGAGGG No data
988963068_988963075 -6 Left 988963068 5:36388879-36388901 CCATTTCCACTCCCAAGCTGCTA No data
Right 988963075 5:36388896-36388918 CTGCTATTTGCTTGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988963075 Original CRISPR CTGCTATTTGCTTGGAAGGA GGG Intergenic
No off target data available for this crispr