ID: 988973349

View in Genome Browser
Species Human (GRCh38)
Location 5:36491304-36491326
Sequence CTCCTACCCTTGGTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988973345_988973349 -3 Left 988973345 5:36491284-36491306 CCTCCATGATATTGGCAGATCTC No data
Right 988973349 5:36491304-36491326 CTCCTACCCTTGGTGTAGCTGGG No data
988973344_988973349 -2 Left 988973344 5:36491283-36491305 CCCTCCATGATATTGGCAGATCT No data
Right 988973349 5:36491304-36491326 CTCCTACCCTTGGTGTAGCTGGG No data
988973346_988973349 -6 Left 988973346 5:36491287-36491309 CCATGATATTGGCAGATCTCCTA No data
Right 988973349 5:36491304-36491326 CTCCTACCCTTGGTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988973349 Original CRISPR CTCCTACCCTTGGTGTAGCT GGG Intergenic
No off target data available for this crispr