ID: 988974188

View in Genome Browser
Species Human (GRCh38)
Location 5:36499160-36499182
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988974185_988974188 21 Left 988974185 5:36499116-36499138 CCTATAGTGATAATTCTGAATCA No data
Right 988974188 5:36499160-36499182 CCTAAAATGTTCCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type