ID: 988979836

View in Genome Browser
Species Human (GRCh38)
Location 5:36556126-36556148
Sequence CTACCACCATTTATGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988979832_988979836 1 Left 988979832 5:36556102-36556124 CCAGCTTCAATCTTATTCATATG No data
Right 988979836 5:36556126-36556148 CTACCACCATTTATGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988979836 Original CRISPR CTACCACCATTTATGGAATA GGG Intergenic
No off target data available for this crispr