ID: 988981378

View in Genome Browser
Species Human (GRCh38)
Location 5:36572740-36572762
Sequence ATGGGCAGGTGGAATAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988981378_988981387 1 Left 988981378 5:36572740-36572762 CCATCCCTATTCCACCTGCCCAT No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988981378 Original CRISPR ATGGGCAGGTGGAATAGGGA TGG (reversed) Intergenic
No off target data available for this crispr