ID: 988981387

View in Genome Browser
Species Human (GRCh38)
Location 5:36572764-36572786
Sequence CAATTGGTCACCAAGTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988981376_988981387 15 Left 988981376 5:36572726-36572748 CCGCTGACTCCTCACCATCCCTA No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981375_988981387 19 Left 988981375 5:36572722-36572744 CCTACCGCTGACTCCTCACCATC No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981379_988981387 -3 Left 988981379 5:36572744-36572766 CCCTATTCCACCTGCCCATCCAA No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981380_988981387 -4 Left 988981380 5:36572745-36572767 CCTATTCCACCTGCCCATCCAAT No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981374_988981387 28 Left 988981374 5:36572713-36572735 CCTGGAGGACCTACCGCTGACTC No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981378_988981387 1 Left 988981378 5:36572740-36572762 CCATCCCTATTCCACCTGCCCAT No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981377_988981387 6 Left 988981377 5:36572735-36572757 CCTCACCATCCCTATTCCACCTG No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data
988981382_988981387 -10 Left 988981382 5:36572751-36572773 CCACCTGCCCATCCAATTGGTCA No data
Right 988981387 5:36572764-36572786 CAATTGGTCACCAAGTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988981387 Original CRISPR CAATTGGTCACCAAGTACCA TGG Intergenic
No off target data available for this crispr