ID: 988983305

View in Genome Browser
Species Human (GRCh38)
Location 5:36593309-36593331
Sequence TGGAACACTGCCCATGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988983305_988983315 23 Left 988983305 5:36593309-36593331 CCAACCCCATGGGCAGTGTTCCA No data
Right 988983315 5:36593355-36593377 AAAAGACAAAGAAATGCAAAGGG No data
988983305_988983314 22 Left 988983305 5:36593309-36593331 CCAACCCCATGGGCAGTGTTCCA No data
Right 988983314 5:36593354-36593376 CAAAAGACAAAGAAATGCAAAGG No data
988983305_988983311 -9 Left 988983305 5:36593309-36593331 CCAACCCCATGGGCAGTGTTCCA No data
Right 988983311 5:36593323-36593345 AGTGTTCCAGGGAAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988983305 Original CRISPR TGGAACACTGCCCATGGGGT TGG (reversed) Intergenic
No off target data available for this crispr