ID: 988984196

View in Genome Browser
Species Human (GRCh38)
Location 5:36600855-36600877
Sequence GGATGCAATCATAGTAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988984196_988984202 24 Left 988984196 5:36600855-36600877 CCCAGATTACTATGATTGCATCC No data
Right 988984202 5:36600902-36600924 CTAAGGTTGATTTGTGCTCAAGG No data
988984196_988984200 7 Left 988984196 5:36600855-36600877 CCCAGATTACTATGATTGCATCC No data
Right 988984200 5:36600885-36600907 AAAAGTTATTTCAGCCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988984196 Original CRISPR GGATGCAATCATAGTAATCT GGG (reversed) Intergenic
No off target data available for this crispr