ID: 988984420

View in Genome Browser
Species Human (GRCh38)
Location 5:36602928-36602950
Sequence GTGTCAGCCGACCCCTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988984415_988984420 4 Left 988984415 5:36602901-36602923 CCACCTACAGGAGGCAGCCTTGG No data
Right 988984420 5:36602928-36602950 GTGTCAGCCGACCCCTTCAAGGG No data
988984417_988984420 1 Left 988984417 5:36602904-36602926 CCTACAGGAGGCAGCCTTGGCTC No data
Right 988984420 5:36602928-36602950 GTGTCAGCCGACCCCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988984420 Original CRISPR GTGTCAGCCGACCCCTTCAA GGG Intergenic
No off target data available for this crispr