ID: 988988079

View in Genome Browser
Species Human (GRCh38)
Location 5:36640508-36640530
Sequence CCATCCAGGTTTTCTTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988988075_988988079 17 Left 988988075 5:36640468-36640490 CCATCTTTGTGTTTATTTTTTAA 0: 1
1: 0
2: 27
3: 501
4: 4314
Right 988988079 5:36640508-36640530 CCATCCAGGTTTTCTTCAAAGGG 0: 1
1: 1
2: 1
3: 13
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988988079 Original CRISPR CCATCCAGGTTTTCTTCAAA GGG Intronic
902150376 1:14438157-14438179 CCATCCAGGGCATCTGCAAAGGG - Intergenic
902724766 1:18327485-18327507 CCATCCAGGTGTCCATCAACAGG + Intronic
903030581 1:20461374-20461396 CAAGCAAGGTGTTCTTCAAAAGG + Intergenic
903753482 1:25644884-25644906 CCATCCAGGTTTTCCTCAAATGG - Intronic
903949657 1:26988676-26988698 TCTTCCAGATTTTCTACAAAAGG + Intergenic
904135003 1:28305380-28305402 CAATCCAGATGTTCTTCAATAGG - Intergenic
904578371 1:31521274-31521296 CCTTCCAGGTCTGGTTCAAATGG - Intergenic
904974776 1:34447669-34447691 CCTCCAAGGTTTTCTTCCAAGGG - Intergenic
908444275 1:64187066-64187088 CCACCCAGGTTTCCTTCCACTGG - Intergenic
910492230 1:87785248-87785270 TCTTCCAGGTTTTCTTCCTACGG + Intergenic
911743101 1:101409328-101409350 TCATCCAGGTTTGCCTCAGATGG + Intergenic
914863413 1:151405501-151405523 CCACCCTGGTTTTCTACAGAGGG - Exonic
918366230 1:183810747-183810769 CTATCCATGTTGCCTTCAAATGG + Intronic
919996477 1:202756102-202756124 GCCTTCAGGTTTTCTTCAGAAGG + Intronic
921057958 1:211558582-211558604 CAATGCAGATTTTCTTGAAACGG + Intergenic
921520437 1:216149733-216149755 CCAGCTAGGTTGTCTTCATATGG - Intronic
922243184 1:223770151-223770173 CCATCAAGGGTTTCCTGAAAAGG + Intronic
923280737 1:232440781-232440803 CCTCCCAGGGTTTCTTCAAGGGG + Intronic
923864379 1:237923572-237923594 GTATCCATGTTTTCTTCTAAGGG + Intergenic
924546847 1:245035933-245035955 ACATCAATGTTTTCTTCTAAGGG - Intronic
1063028608 10:2208530-2208552 ACGTCCAGATTTCCTTCAAATGG + Intergenic
1065219483 10:23481491-23481513 TCATCCAGGCTTTCTTCTTATGG - Intergenic
1070645232 10:78197475-78197497 TCATCCAGGTTTTCATCTAAAGG - Intergenic
1072365930 10:94709696-94709718 CACCCCAAGTTTTCTTCAAATGG + Intronic
1073126282 10:101152121-101152143 CCAGCCAGGTTTTCATCCTATGG + Intergenic
1073618652 10:105024268-105024290 CCTTACTGGTTTTCCTCAAAAGG + Intronic
1073632126 10:105159620-105159642 CCATCAATGTATTCTTGAAAAGG - Intronic
1074099447 10:110342792-110342814 CAATCCAGGCTATCTTCACAGGG - Intergenic
1075023552 10:118967957-118967979 CGCTCCAGGCTTTCTCCAAAGGG - Intergenic
1075173139 10:120134460-120134482 CCAATCAGGTTATCATCAAAAGG + Intergenic
1079813125 11:25021250-25021272 TAATCCAGGTTATATTCAAATGG + Intronic
1080911954 11:36610011-36610033 CCATCCAGAATATTTTCAAAGGG + Intronic
1080996956 11:37615368-37615390 CCCTCCAGGTCTTCCTTAAATGG - Intergenic
1083165700 11:60885452-60885474 CCATTCAGAATTGCTTCAAAGGG + Intergenic
1083923097 11:65790946-65790968 CCATCCAGGACTTGTTGAAATGG - Intronic
1084429041 11:69101276-69101298 CCATCTGGGGCTTCTTCAAAAGG - Intergenic
1087522396 11:99257246-99257268 CCTTCCTGGTTTTATTCACATGG - Intronic
1090224322 11:125060889-125060911 TCTTCCCTGTTTTCTTCAAAGGG - Intergenic
1091076285 11:132620640-132620662 CCATGCAGGATGTCTACAAAGGG + Intronic
1091169166 11:133505320-133505342 AGCTCCTGGTTTTCTTCAAAAGG + Intronic
1091287888 11:134418502-134418524 CCAGCTATGTTTTCTGCAAACGG + Intergenic
1091975990 12:4825952-4825974 TCATCAATGTTTTCATCAAAAGG - Intronic
1094010536 12:25804359-25804381 CCTTGCAGCTTCTCTTCAAATGG + Intergenic
1094370351 12:29730832-29730854 CCATTCAGTATTTGTTCAAAAGG + Intronic
1098249883 12:68558437-68558459 TCATCTAGGTTTTATTCACAAGG - Intergenic
1098470178 12:70833861-70833883 CCATGCAATTCTTCTTCAAAAGG + Intronic
1100799485 12:98216274-98216296 CCATCTACCTTTTCTCCAAAAGG + Intergenic
1101567878 12:105926407-105926429 CCATGGAGGTCTTCTTCCAAAGG - Intergenic
1106563547 13:30866681-30866703 ACAACCTGGATTTCTTCAAATGG - Intergenic
1107201954 13:37731995-37732017 CCATCAAGGTATTATACAAATGG + Intronic
1107660261 13:42631898-42631920 CCATTCACCTTTTCTCCAAACGG + Intergenic
1108103797 13:46987131-46987153 CAATCAAGATTTTCTTCAATAGG - Intergenic
1108487863 13:50945244-50945266 CCACTCAGCCTTTCTTCAAATGG + Intronic
1108863672 13:54895388-54895410 CTGTCCAGGTTTTCCTCAAAAGG + Intergenic
1109147198 13:58794123-58794145 CCATGAATGTTTTATTCAAAAGG + Intergenic
1110297192 13:73881467-73881489 CCATTCATTTTTTTTTCAAATGG + Intronic
1112392343 13:98997057-98997079 CTATCCAGGGTTTCTACAAGAGG + Intronic
1113124420 13:106960982-106961004 CCAACCAGGTTTTCATAGAAAGG + Intergenic
1114198569 14:20501578-20501600 CCATCCAAATGTTCTTCAATGGG - Intergenic
1115034407 14:28839693-28839715 CCCTCCAAGTTTTCTCCAAAGGG + Intergenic
1116721159 14:48497480-48497502 CCATCCTGATTTTCTTGAAAAGG - Intergenic
1118034852 14:61855857-61855879 CCATTCAGGTTTATTACAAAAGG - Intergenic
1118707451 14:68493337-68493359 CCATCCAGATTTTTCTTAAAAGG - Intronic
1119986614 14:79145596-79145618 CCAGACAGGTCTTCCTCAAAAGG + Intronic
1120162096 14:81156741-81156763 CCATCAGGGCTTTATTCAAATGG + Intergenic
1120611052 14:86641950-86641972 TCATCCATGTTTTCAACAAATGG - Intergenic
1122041370 14:98989988-98990010 CCAGCTAGGTTGTCTTCATATGG - Intergenic
1123507499 15:20959045-20959067 CCTTGCAGATTATCTTCAAAAGG + Intergenic
1123564724 15:21532788-21532810 CCTTGCAGATTATCTTCAAAAGG + Intergenic
1123600980 15:21970079-21970101 CCTTGCAGATTATCTTCAAAAGG + Intergenic
1128788927 15:70418480-70418502 CCCGCCAGGTTTTCTCCTAACGG - Intergenic
1128925921 15:71655877-71655899 CCATCCAGATCTTCTTCCCAAGG - Intronic
1129152203 15:73696256-73696278 CCACCCATGTTTTCCACAAAGGG - Intronic
1129627858 15:77223231-77223253 ACTTCCAAGTTTGCTTCAAAAGG - Intronic
1130271618 15:82453458-82453480 CCATCTTGCTTTTCTTAAAAAGG + Intergenic
1130463964 15:84180845-84180867 CCATCTTGTTTTTCTTAAAAAGG + Intronic
1130488717 15:84413988-84414010 CCATCTTGCTTTTCTTAAAAAGG - Intergenic
1130500302 15:84492696-84492718 CCATCTTGTTTTTCTTAAAAAGG - Intergenic
1202973088 15_KI270727v1_random:259899-259921 CCTTGCAGATTATCTTCAAAAGG + Intergenic
1133159172 16:3898348-3898370 CCACCCAGGTGTTCTTCCATGGG + Intergenic
1133727009 16:8547261-8547283 TCAACCAGGATTTCTCCAAAGGG + Intergenic
1135622833 16:23970550-23970572 CCTTCCCATTTTTCTTCAAAGGG + Intronic
1136119290 16:28120143-28120165 CCATGCAGTTTATTTTCAAATGG + Intronic
1137868104 16:51922295-51922317 CTAGCAAGATTTTCTTCAAAAGG + Intergenic
1138038973 16:53641411-53641433 CCATCCATGTTATATTGAAATGG - Exonic
1139482542 16:67238435-67238457 CTATACAGCTTTTCTGCAAAAGG + Exonic
1140258332 16:73356123-73356145 CCAACCAGGTTTTCGTTGAATGG + Intergenic
1140542572 16:75771092-75771114 CCATCAAGATTTTCTTCAGCAGG + Intergenic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1143073840 17:4322281-4322303 CAATCCAAGATTTCTTCCAAAGG + Intronic
1146051226 17:29555136-29555158 CCATGCACGTTATCTACAAATGG - Intergenic
1146975708 17:37109774-37109796 CCATCCAGTCCTTCTGCAAAAGG + Intronic
1149438753 17:56656865-56656887 CCAACTGGATTTTCTTCAAATGG - Intergenic
1149520602 17:57315488-57315510 CCAGCCAGGTTTTCTGGAAATGG + Intronic
1152974912 18:205958-205980 CAACCCAGGTGTTCTTCAATAGG - Intronic
1153112799 18:1612619-1612641 CCATTCAGGTTTCCTAGAAATGG + Intergenic
1153349065 18:4058774-4058796 CCTTCAAGGTCTTATTCAAAGGG + Intronic
1157204065 18:45683693-45683715 GCATCAGGGTTTTCTTAAAACGG + Intergenic
1157650481 18:49324561-49324583 CCAGCCATGTTTTCTCCAACTGG - Intronic
1158486884 18:57875266-57875288 TCATACCTGTTTTCTTCAAAAGG - Intergenic
1160977704 19:1801985-1802007 CCAGCTTGGTTCTCTTCAAATGG + Exonic
1161562730 19:4982473-4982495 ACATCCAGGTTTTCTTCTAGAGG - Intronic
1161709389 19:5839276-5839298 CCATCCCTTTTTTATTCAAAAGG - Exonic
1162173459 19:8810544-8810566 CCATACAGATTGTCCTCAAAAGG + Exonic
1163899706 19:20090608-20090630 CCAGCTAGGTTGTCTTCATATGG + Intronic
1167935498 19:52903531-52903553 CCATCCAGGCTTCCTTCTGATGG + Intergenic
925812543 2:7714650-7714672 CCATCCAGGTACTTTTCAGAAGG - Intergenic
928035580 2:27819499-27819521 CCATCCAGGACTGTTTCAAATGG + Intronic
928117572 2:28557949-28557971 CCACCCAGGTTTGCTTCATCTGG + Intronic
928566996 2:32562836-32562858 CAATCAAGATGTTCTTCAAAAGG - Intronic
928740763 2:34349502-34349524 CTAGCCATGTTGTCTTCAAAGGG + Intergenic
929935280 2:46290398-46290420 CATCCCTGGTTTTCTTCAAAGGG + Intergenic
932052755 2:68415380-68415402 CTATCAAGCTGTTCTTCAAAGGG - Intergenic
932453257 2:71829662-71829684 CCTTCCAGGTTTCCTGCCAAGGG + Intergenic
933068767 2:77832745-77832767 CCATCAAGGTCATATTCAAAAGG + Intergenic
934696715 2:96405348-96405370 CCATCCAGGTCCCCCTCAAAGGG - Intergenic
937053199 2:118908976-118908998 CCAAGAAGGCTTTCTTCAAAAGG - Intergenic
940793552 2:158053230-158053252 CCCTCCAGGTTTTGTTAGAAAGG - Intronic
941180980 2:162258947-162258969 CATTCCAGGCTTTCTTCACATGG + Intergenic
941325644 2:164110651-164110673 CCAAACAGGTTTTCTACAAAAGG - Intergenic
941455688 2:165710483-165710505 CCAGCTAGGTTGTCTTCATATGG + Intergenic
941694662 2:168538181-168538203 TCATTTAGGTTTTCTTCACATGG + Intronic
943412484 2:187560843-187560865 CCAGCTAGGTTGTCTTCATATGG + Intronic
944879963 2:204002693-204002715 CCTTCTATGTTTTCTTCAGAAGG - Intergenic
946086669 2:217180456-217180478 GCATTCATGTTTTCTTTAAATGG + Intergenic
948156322 2:235785902-235785924 CCATCCACGTTTTTTTTAAAAGG - Intronic
1172310903 20:33917771-33917793 CCCTGCAGGTTGTCTCCAAAAGG + Intergenic
1173580429 20:44143149-44143171 TCAGCCATGTTTCCTTCAAAGGG - Intronic
1175064472 20:56273321-56273343 CAACCCAGTTTTTCTTCACAAGG + Intergenic
1176365480 21:6030148-6030170 CCATCCAGGTGTTCCTCCCAGGG + Intergenic
1177395415 21:20529257-20529279 CCATGCAAGTTTCCTTAAAATGG - Intergenic
1179608930 21:42536466-42536488 CCAGCCAGGTTTTTTTTTAAAGG + Intronic
1179758038 21:43508397-43508419 CCATCCAGGTGTTCCTCCCAGGG - Intergenic
1180202607 21:46234482-46234504 CCATCCAGGTGAAATTCAAAGGG - Intergenic
1181646005 22:24232190-24232212 CCAGCCAGCTCTTCTTCAACGGG - Exonic
1182134450 22:27888150-27888172 CCCTCCAGGTTGTCTTGAAAAGG + Intronic
1182780595 22:32864367-32864389 CCACCCAGGTATCCTCCAAATGG + Intronic
950017153 3:9762319-9762341 CCATCCAAGTTTTCTACAGAAGG + Intronic
955452628 3:59086401-59086423 CAGAACAGGTTTTCTTCAAAGGG - Intergenic
956143442 3:66168797-66168819 CCATGCAGGTTTTCCTGATAGGG + Intronic
958061870 3:88494235-88494257 TCATCCATGTTTTTTGCAAATGG + Intergenic
958709193 3:97696557-97696579 GCTTAGAGGTTTTCTTCAAAGGG - Intronic
959983044 3:112539453-112539475 CCTTCCAGGCTTTATTTAAATGG + Intronic
963204904 3:142623202-142623224 CCAAGCAGGTTTTCTTCCTATGG - Intronic
963436203 3:145270095-145270117 CCATCCAGGCTTTCTTGTTATGG - Intergenic
965001657 3:162962077-162962099 CCATTCACAATTTCTTCAAAGGG + Intergenic
966682564 3:182658299-182658321 CCATCAACCTTTTCTTAAAATGG + Intergenic
968317161 3:197734907-197734929 CAGTCCAGGTTTTGTTCAACAGG + Intronic
969299103 4:6287119-6287141 CTCTCCAGGACTTCTTCAAAGGG - Exonic
971808384 4:31390990-31391012 CCTCCCAGGTTTTCTCCATAGGG + Intergenic
972471585 4:39410886-39410908 CCATTCAGGTTTCCTCCAAATGG - Intronic
972822752 4:42721010-42721032 GCATCCAGGCAATCTTCAAAAGG - Intergenic
973022129 4:45216899-45216921 CCATACCGGTTTCCTTCAAGTGG - Intergenic
975491495 4:74994160-74994182 GCAAGCTGGTTTTCTTCAAAAGG - Intronic
977549931 4:98430179-98430201 CCATCCACCTTTTCCTAAAAGGG - Intronic
980973914 4:139592648-139592670 CCATCCACTTTTTCCTCCAAGGG - Intronic
986601366 5:9476542-9476564 CCATCCAGCCTGTCTTCAGAGGG - Intronic
988988079 5:36640508-36640530 CCATCCAGGTTTTCTTCAAAGGG + Intronic
989443935 5:41506863-41506885 GAATCCATGTTTTCTTCAACAGG - Intronic
990222168 5:53604874-53604896 CCATCTACCTATTCTTCAAATGG + Intronic
990819305 5:59819350-59819372 TCTTGCATGTTTTCTTCAAAAGG + Intronic
992844598 5:80733665-80733687 CCATACAGGTTTTTCTCCAAAGG + Intronic
992956662 5:81916687-81916709 CCATTCAGGTTTTTTTCCTATGG + Intergenic
994115493 5:96057498-96057520 CCCTTCAGCTTTTCTTCATAAGG + Intergenic
997070088 5:130611395-130611417 CCATTCACATTTGCTTCAAAGGG + Intergenic
997795666 5:136808308-136808330 TCATTCAGGTATTCATCAAAAGG + Intergenic
999184928 5:149700234-149700256 CCTTCCAGTTTTCTTTCAAAAGG + Intergenic
999416589 5:151402716-151402738 CCATCCAAGATTTATTCAGAAGG - Intergenic
999802416 5:155050248-155050270 CCATGCAGTTTCTCTTTAAAGGG - Intergenic
1000257510 5:159554263-159554285 CCATCAAAGTTTTCTTTAAGAGG - Intergenic
1003999460 6:11583155-11583177 CCATTCTCATTTTCTTCAAAGGG + Exonic
1004926232 6:20417768-20417790 AGACACAGGTTTTCTTCAAAAGG - Intronic
1005306879 6:24522432-24522454 CAATCCATGTTTTTTTCAAATGG - Intronic
1005441119 6:25870014-25870036 CAATGCAGTTTTTCATCAAAAGG - Intronic
1005609113 6:27506498-27506520 CCATCAACTTTTTCTTCAGAGGG - Intergenic
1008144927 6:47879594-47879616 CGATCCAGGTATTCTGCAGAAGG + Exonic
1009540627 6:64953129-64953151 CAATCCAAGTTTTCTTTCAATGG - Intronic
1010750125 6:79608268-79608290 CCCTCCAGTGTTTCTTCAATTGG + Intergenic
1012025329 6:93982836-93982858 TGTTCCAGGTTTTGTTCAAAGGG - Intergenic
1013390100 6:109678155-109678177 CAACCCAGATGTTCTTCAAAAGG + Intronic
1014365451 6:120535266-120535288 TCATGCAGATTTTTTTCAAAAGG + Intergenic
1017027571 6:150195041-150195063 TCATACAGGTTATATTCAAAAGG - Intronic
1017280523 6:152619428-152619450 CCATCCAGGTTTTCATGGAGAGG + Intronic
1017317319 6:153046759-153046781 CCAACAAGATTTTCTTCATAAGG + Intronic
1017508417 6:155090021-155090043 CCATCCATTCTATCTTCAAATGG + Intronic
1021089043 7:16459603-16459625 ACATCAAGGACTTCTTCAAATGG - Intergenic
1023233549 7:38059898-38059920 TCATCCAGCTCTTTTTCAAAAGG + Intergenic
1028736823 7:94223335-94223357 CTATGCAGGTTTTCTTCAAAAGG - Intergenic
1029163990 7:98573085-98573107 CCATCCAAGTGTCCTTCAACTGG - Intergenic
1029333345 7:99878620-99878642 CCAACCAGATGGTCTTCAAAAGG - Intronic
1032504187 7:132423546-132423568 CCATCCAGCTTTTCTAGAGATGG + Intronic
1033382467 7:140836243-140836265 GCATCCCTGTTTTCTTAAAAAGG + Intronic
1033499071 7:141929481-141929503 GCTGCCTGGTTTTCTTCAAAGGG + Exonic
1038460552 8:27712678-27712700 CCATCAAGATGTTCTTCAGAGGG - Intergenic
1041158348 8:55011053-55011075 TAATCCAGGTTTTCTCCAGAAGG + Intergenic
1041507871 8:58621254-58621276 CCATCCAGTGTTGCTGCAAAGGG + Intronic
1042991293 8:74643175-74643197 CCAACCTGGTTGCCTTCAAAAGG + Intronic
1046956854 8:120070926-120070948 CCTTCCAGGTTATCTTAAATTGG - Intronic
1047899410 8:129403833-129403855 CCATCAAGTCTTTGTTCAAAGGG + Intergenic
1048015275 8:130491381-130491403 CGCTCCAGGCTTTCTTCAGAAGG + Intergenic
1048937083 8:139366445-139366467 CCATCCCTGTCTTCTTTAAAGGG + Intergenic
1050342334 9:4653399-4653421 ACATCTATGTTTTCTTCTAATGG - Intronic
1050599068 9:7232637-7232659 CCATCCAGATATCCTTCAATAGG + Intergenic
1050722053 9:8601324-8601346 CCATCCAGGCCTTCTTTTAAGGG - Intronic
1051059547 9:13030240-13030262 CCATTCAGGTTTTATTCTATTGG - Intergenic
1051702647 9:19840988-19841010 CCATCCAGCTGTTCATCAACAGG - Intergenic
1057364343 9:94404936-94404958 TCCTCCATGTTTTCTTCTAAGGG + Intronic
1057658988 9:96983133-96983155 TCCTCCATGTTTTCTTCTAAGGG - Intronic
1057750682 9:97790335-97790357 CCATCCTGGTTTTCTCAAGATGG + Intergenic
1059245427 9:112845659-112845681 CCGTCCAGATTTTCTAGAAAAGG - Intronic
1060226585 9:121795119-121795141 CCAGCTAGGTTGTCTTCATAGGG - Intergenic
1185518383 X:717931-717953 CCTTCCAGTTTCTCTTCAACAGG + Intergenic
1186281785 X:8000902-8000924 CCATCTCTCTTTTCTTCAAATGG + Intergenic
1186424523 X:9453505-9453527 CAATCCAGGTGTCCTTCAACTGG - Intergenic
1187726457 X:22208184-22208206 AAATCCTGATTTTCTTCAAAAGG + Intronic
1189818366 X:44846362-44846384 ACACACAGGTCTTCTTCAAATGG - Intergenic
1190406924 X:50097510-50097532 ACATGCTGTTTTTCTTCAAAAGG - Exonic
1195000134 X:100636027-100636049 CCTTCAAGGTTTTCTTCCTAAGG - Intronic
1196114102 X:111980066-111980088 CAATCCAGTTGTTCTTCAACAGG + Intronic
1196960003 X:120991021-120991043 GCATTCAGGTTTTAGTCAAAGGG + Intergenic
1197830677 X:130639167-130639189 CCATCCTGGTCTTCTTCACAAGG + Intronic
1197878054 X:131132635-131132657 CAACCCAGGTGTTCTTCAACAGG - Intergenic
1198103256 X:133439934-133439956 TCCTCCAGTTTTCCTTCAAAGGG - Intergenic
1201618606 Y:15929442-15929464 CCATTCACATTTGCTTCAAAGGG + Intergenic
1202371243 Y:24197792-24197814 CCATCTTGTTTTTCTTAAAAAGG - Intergenic
1202499541 Y:25472325-25472347 CCATCTTGTTTTTCTTAAAAAGG + Intergenic