ID: 988989662

View in Genome Browser
Species Human (GRCh38)
Location 5:36658006-36658028
Sequence GCACATTGCCTGCCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988989662_988989667 26 Left 988989662 5:36658006-36658028 CCTGTTTTGGGCAGGCAATGTGC 0: 1
1: 0
2: 0
3: 9
4: 168
Right 988989667 5:36658055-36658077 AAGAGACTTTGCCAGTCTCTAGG 0: 1
1: 0
2: 0
3: 17
4: 222
988989662_988989665 -10 Left 988989662 5:36658006-36658028 CCTGTTTTGGGCAGGCAATGTGC 0: 1
1: 0
2: 0
3: 9
4: 168
Right 988989665 5:36658019-36658041 GGCAATGTGCTAACCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988989662 Original CRISPR GCACATTGCCTGCCCAAAAC AGG (reversed) Intronic
901058870 1:6462458-6462480 GCACAGTGCCTGCCCTCAAGGGG - Intronic
901592151 1:10353544-10353566 GCACACTGCCTTCCCACCACAGG + Intronic
902343833 1:15801299-15801321 GCACATAGCCTGCATAGAACAGG + Intergenic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
904237988 1:29126107-29126129 GCACAGTGTCTGCCCACAGCTGG + Intergenic
906578355 1:46911706-46911728 GGACGTTGTCTGCCAAAAACTGG - Intergenic
908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG + Intergenic
908686331 1:66724151-66724173 ACACATTCCCTGAACAAAACTGG + Intronic
910674050 1:89799659-89799681 GCAGGTTTCCTGCCCACAACGGG + Intronic
912055061 1:105585782-105585804 GCAGATTGCCTTCCCAACATGGG + Intergenic
913387831 1:118279115-118279137 GCAAATTGCCTGGACAAAAGTGG - Intergenic
913529093 1:119720750-119720772 GCACATTGCTTGCTCAAAATGGG - Intronic
917416360 1:174814493-174814515 GCACAATCCCAGCCCAATACTGG - Intronic
924572554 1:245250495-245250517 GCACATTACATGACCAAGACAGG - Intronic
1063385826 10:5615978-5616000 GCACAGTGCCTGCCCATAGCTGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1069211487 10:65766610-65766632 TCACATTACCTGTCCAACACGGG - Intergenic
1071545585 10:86526546-86526568 GCACATTGCCTGACAAGGACCGG + Intergenic
1074338993 10:112607506-112607528 GCACAGTGCCTGGCCTAAAATGG + Intronic
1076546227 10:131247105-131247127 CCACAGTGCCATCCCAAAACAGG + Intronic
1077411905 11:2407581-2407603 GGGCTTTGCCTGCCCAAGACCGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079006960 11:16798260-16798282 GCACAGTGCCTGCTCAAAGCAGG + Intronic
1080591220 11:33724513-33724535 GCACAATGCCTGGCCAAAGATGG + Intronic
1083711781 11:64554204-64554226 GCACGGTGCTTGCTCAAAACAGG + Intergenic
1084958595 11:72704280-72704302 GCACGTTGGCTGCCCAGAAGCGG + Exonic
1086286591 11:85258867-85258889 ACACTTTGCCTGAACAAAACAGG - Intronic
1086498755 11:87430905-87430927 GCACCGTGGCTGCCCAAAGCAGG - Intergenic
1092917021 12:13198455-13198477 GAGCATTGCCTGCTCAACACAGG - Intronic
1095262664 12:40115361-40115383 GAACATTGCCTTGCCAAAATAGG + Intergenic
1097168754 12:57100141-57100163 GCTCACTGCCTGCCCTAAACAGG - Intronic
1098454308 12:70654889-70654911 GCACTTTGGCAGGCCAAAACAGG - Intronic
1099203649 12:79703746-79703768 GCACTTTGGCAGCCCAAAGCGGG + Intergenic
1099889921 12:88579044-88579066 GGACATTGCCTGGCTAAAAGAGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1102133188 12:110550005-110550027 CCAGATTGCATGTCCAAAACAGG + Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1105067210 12:133210925-133210947 GCACATGGCCATCACAAAACAGG - Exonic
1105675472 13:22666905-22666927 GCACATTATATGCCCAAAAATGG + Intergenic
1110402001 13:75102886-75102908 GCACAAAGCCTGCCCAGAAGAGG + Intergenic
1111555263 13:89872837-89872859 GTACATTGCCTGGCCAATATGGG + Intergenic
1112566358 13:100554131-100554153 GGACATTGCCTGGCCTGAACTGG + Intronic
1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG + Intergenic
1117966564 14:61212693-61212715 GCACAGTGCCTGCCAAATAGTGG - Intronic
1118170667 14:63385616-63385638 GCACAGTGCCTGCCCATAGGAGG - Intronic
1118719989 14:68587113-68587135 GCACAGTGCCTGCGCATAAGAGG + Intronic
1121799486 14:96762414-96762436 TCATATTGCCTGCACAAAATGGG + Intergenic
1122180523 14:99951040-99951062 GCTCAGTGCCTCCCCAACACAGG - Intergenic
1124925713 15:34068451-34068473 GCACTTTGCCAGGCCAAATCGGG - Intergenic
1127628092 15:60800086-60800108 TCACGTTGGTTGCCCAAAACTGG + Intronic
1129129020 15:73474089-73474111 GAATATTGCCTGCCCTAAAGGGG + Intronic
1129251906 15:74313856-74313878 CCACTTTGCCTGCCTATAACAGG + Intronic
1129293185 15:74584345-74584367 GCACATTCCCTGCTTAACACAGG + Intronic
1130726032 15:86440531-86440553 GCACATTGCCTGGAATAAACTGG - Intronic
1132243835 15:100279568-100279590 GCACAGTGCCTGGCCACAAATGG - Intronic
1133155039 16:3868356-3868378 GCCCTTTTCCTGCCAAAAACGGG + Intronic
1134129257 16:11637552-11637574 GCACAGTGCCTGCCCATGAGGGG + Intergenic
1135399919 16:22159580-22159602 GCACAGAGCCTGGCCAAAGCAGG - Intergenic
1135653100 16:24224177-24224199 GCATATGGCCTGCCAAAATCAGG + Intergenic
1136998876 16:35211211-35211233 GCAAACTGCCTGCCAAACACAGG + Intergenic
1137010987 16:35319973-35319995 GCAAACTGCCTGCCAAACACAGG + Intergenic
1137029722 16:35510518-35510540 GCAAACTGCCTGCCAAACACAGG - Intergenic
1138221509 16:55255729-55255751 GCACCTTTTCTGCCCAAAAGGGG + Intergenic
1139601856 16:67992175-67992197 GCACATAGGCTGACCAGAACTGG + Exonic
1139921616 16:70464104-70464126 TCACATGGCCTGCCCAAAGCAGG - Intronic
1146374878 17:32287336-32287358 GCACATTGTGAGCCCAAGACAGG - Intronic
1149412906 17:56427365-56427387 GTACATTGCTGGCCCATAACTGG - Intronic
1152341130 17:79725711-79725733 GCACTTTGCAAGGCCAAAACGGG + Intergenic
1152497868 17:80687104-80687126 GCACTTTGCCTGCAGAAAAGGGG - Intronic
1153530823 18:6043693-6043715 GTACATTGCTTACCCAAACCAGG - Intronic
1153958069 18:10115141-10115163 CCACATTGGCTTCCCACAACTGG + Intergenic
1154339333 18:13490096-13490118 GCAGATGGAGTGCCCAAAACAGG - Intronic
1155261648 18:24049530-24049552 GCACAGTGCCTACCCAGCACAGG - Intronic
1156381346 18:36564195-36564217 GCACACAGCCTCTCCAAAACAGG - Intronic
1158987385 18:62832142-62832164 GCACAGTGCCTTCCCCAAAGAGG - Intronic
1159334136 18:67041953-67041975 GCACAGTGCCTGCCTCAAATTGG - Intergenic
1159963338 18:74572871-74572893 GCAATTTGTCTGCCCAAAAGGGG - Intronic
1161690524 19:5730666-5730688 GCACATTGATTGGCCAAGACAGG + Intronic
1166127751 19:40725855-40725877 GCACTTTGGCAGGCCAAAACAGG + Intronic
929825043 2:45303464-45303486 GCACAGTGCCTGCACAAAGTAGG + Intergenic
930059758 2:47278257-47278279 GCAGATTGCCTGCCCTAATGTGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
933774266 2:85762457-85762479 GCACAGGTCCTGCCCATAACAGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
938393470 2:130923533-130923555 GAACATTGCCCGCCCACAAGTGG - Intronic
939422018 2:141983812-141983834 GCACTTTGCCAGACCAAGACGGG + Intronic
944582921 2:201148371-201148393 GCACAATCTCTGCTCAAAACTGG + Intronic
944694230 2:202186827-202186849 GCACAGTGCCTGCAGAGAACAGG + Intronic
945138000 2:206650465-206650487 GCTCATAGCCTGTTCAAAACAGG + Intergenic
945614667 2:212053069-212053091 GCACATTGAGAGGCCAAAACAGG + Intronic
946005222 2:216519282-216519304 GCACATTCTGTGCCCCAAACAGG + Intronic
947423064 2:229958060-229958082 TCACTTTGCCTGCCCATATCTGG + Intronic
948236575 2:236395217-236395239 GCAGGTGGCCAGCCCAAAACAGG + Intronic
948836395 2:240628127-240628149 GCACAGTGCCTGCCCAGCTCAGG + Intronic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1169933306 20:10857052-10857074 GGACATTTCTTCCCCAAAACTGG - Intergenic
1173888773 20:46486084-46486106 CCACATTGCCAGCCCTAAACAGG - Intergenic
1177559368 21:22730231-22730253 TCACACTGCCTGCCTAACACCGG - Intergenic
1179486367 21:41713326-41713348 GCACTTTGGGTGCCCAAAGCAGG - Intergenic
1180605662 22:17057259-17057281 TCACAGTGCCTGCCCCAGACAGG + Intergenic
1182738762 22:32550805-32550827 GTACATTTTCTGCCCAAACCTGG - Intronic
1183349506 22:37326981-37327003 GCACAATCCCTGCCCCACACTGG + Intergenic
1183830639 22:40416863-40416885 CCACAGTGCTTGCCCAAGACTGG + Intronic
1184406092 22:44301707-44301729 GCACATTACTCTCCCAAAACAGG + Intronic
949441848 3:4090084-4090106 GCACAGTGCCTGGCCATAGCAGG + Intronic
949449505 3:4169676-4169698 GCAGATTGTCAGCCCCAAACGGG - Intronic
949891634 3:8737695-8737717 GCACATTGCCTGTGCTGAACAGG - Intronic
949900676 3:8812456-8812478 GACCATTGCTTGCCCAAATCCGG - Intronic
958751128 3:98194023-98194045 GCATTTTACCTGTCCAAAACCGG + Intronic
961018165 3:123482996-123483018 TGACATTGCCTGCCCACAGCTGG - Intergenic
961604494 3:128083577-128083599 GCACATTGGCTGCCCACAGATGG + Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
965460440 3:168955413-168955435 GCACATTGAATGCCCAAGTCTGG - Intergenic
965869786 3:173252128-173252150 GCACATTACCTGGCAAAAGCAGG + Intergenic
967489286 3:190070735-190070757 ACACATTGTCTGCCTGAAACGGG + Intronic
969579394 4:8055321-8055343 GCACAGTGCCAGCCCATCACAGG - Intronic
969828321 4:9775665-9775687 GCACATCACGTGGCCAAAACAGG - Intronic
969946909 4:10792928-10792950 GCTCTTTGACTGCCCAAATCAGG + Intergenic
972825757 4:42757210-42757232 GCACATTGGGAGGCCAAAACAGG - Intergenic
976568602 4:86582518-86582540 GCTCTTTGCCCTCCCAAAACAGG + Intronic
977658007 4:99545869-99545891 TGACATTGCCTGCCCTAAAATGG - Intergenic
979615075 4:122733140-122733162 CCAGAATCCCTGCCCAAAACAGG - Intronic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
985270616 4:188191440-188191462 GCACATTGGGAGCCCAAGACAGG + Intergenic
986340345 5:6783957-6783979 GCACAATGCCTGCCCACATGGGG - Intergenic
988398884 5:30734821-30734843 GCAGATTGCCTGCCCAATGTTGG - Intergenic
988989662 5:36658006-36658028 GCACATTGCCTGCCCAAAACAGG - Intronic
989755479 5:44948150-44948172 GCACACTGCCTTCCCAACATAGG - Intergenic
994329166 5:98486236-98486258 CCACATCCCCTGCCCAAAAGGGG + Intergenic
996347351 5:122501395-122501417 GCACATTGCCAAGGCAAAACAGG + Intergenic
998135663 5:139673146-139673168 GCAAATTGCCTGCTCTAAATGGG + Intronic
999712048 5:154327381-154327403 ACACATTTCCTGCCCTAACCTGG - Intronic
1003305429 6:4922780-4922802 GCACATTCGAGGCCCAAAACAGG - Intronic
1008843467 6:55933955-55933977 GCACATTGCCTGAACATAACAGG + Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1011574544 6:88781239-88781261 GCATTTTGCTTGCCTAAAACAGG + Intronic
1012292144 6:97469824-97469846 CCACATTTCCTACTCAAAACTGG - Intergenic
1012888957 6:104877462-104877484 GCACATTTCCTTCCAGAAACAGG - Intergenic
1016386264 6:143533646-143533668 GCACAGTGCCTGGCCCAAAAAGG + Intergenic
1019066098 6:169299283-169299305 GCACATTTTCTGCCCCAACCTGG - Intergenic
1022900969 7:34810577-34810599 GCACATAGGCTCCCTAAAACCGG + Intronic
1024939284 7:54745480-54745502 ACACATTGCCTGCCAAAGAAGGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1031995581 7:128228239-128228261 GCACTTTGGGTGGCCAAAACAGG + Intergenic
1033157183 7:138967127-138967149 GCACAGTGCCTGCACAGAGCAGG + Intronic
1034406761 7:150909149-150909171 GAACATTGCCTTCCTAACACTGG + Intergenic
1035677621 8:1466386-1466408 GCAGATTTCCAGCCCAAAAGAGG - Intergenic
1039360469 8:36871348-36871370 GCACATTGCTTCCCAAAAATGGG - Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1041360340 8:57046352-57046374 GCACAGTGCCTTTCCAATACAGG - Intergenic
1042647242 8:71000864-71000886 GCACACTGCCTGCCCACTAAAGG + Intergenic
1044261300 8:90125951-90125973 GTACTTTTCCTGACCAAAACTGG - Intergenic
1047517730 8:125569636-125569658 GCACGGTGCCTGACCATAACAGG + Intergenic
1047680004 8:127244996-127245018 GCACGTTTCCTGCACAGAACAGG + Intergenic
1047791410 8:128207362-128207384 GCACCTTGCCTGCCCTCAACGGG + Intergenic
1051856416 9:21572238-21572260 GCAGTTTCCCTGCCCATAACAGG + Intergenic
1055034476 9:71803531-71803553 TCAGATTGCCTCTCCAAAACTGG + Intronic
1055055933 9:72024106-72024128 GCACATTGCCTGGTGAGAACAGG + Intergenic
1059001820 9:110356481-110356503 GCACTTTGGCAGCCCAACACAGG - Intergenic
1060555910 9:124507121-124507143 GCACCTTCCCTGCCCAGAGCAGG + Intronic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1186159853 X:6765718-6765740 TCACATTGCATGCCCAAAGAGGG - Intergenic
1187237657 X:17483553-17483575 GCACAATGCCTGACACAAACAGG - Intronic
1187804604 X:23105279-23105301 GCACAGTGCCTGCACATAATAGG + Intergenic
1188529819 X:31127498-31127520 GGAAATTGCATGCCCAAGACAGG - Intronic
1190455065 X:50619051-50619073 GTAAATTGCCTGCCAAAACCAGG + Intronic
1192543074 X:71991470-71991492 TAACTTTGCCTTCCCAAAACAGG + Intergenic
1192963497 X:76153450-76153472 TCACATTGCCTGTCTAAAAATGG + Intergenic
1193211059 X:78807529-78807551 GCACATTTTCTACCTAAAACTGG - Intergenic
1193646741 X:84079388-84079410 GCTCAGTGTCTGCCCAAAAACGG - Intronic
1197554870 X:127940547-127940569 ACACATTGCTTTCCCAATACAGG - Intergenic
1197939767 X:131777499-131777521 GCACATTGGGAGGCCAAAACGGG + Intergenic
1200238306 X:154479737-154479759 CCACTTTGCCTGGCCTAAACTGG - Intergenic
1200901023 Y:8432261-8432283 TCACAATGCCTTCCCAACACAGG + Intergenic
1201550598 Y:15213136-15213158 TCAAATTGCGTGCCCAAAAGTGG + Intergenic