ID: 988990031

View in Genome Browser
Species Human (GRCh38)
Location 5:36661678-36661700
Sequence CAGCTGTTCTTTGGCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 374}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988990026_988990031 15 Left 988990026 5:36661640-36661662 CCAGCCTCATGACTGGGCCTGGA 0: 1
1: 0
2: 0
3: 28
4: 272
Right 988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 374
988990028_988990031 -2 Left 988990028 5:36661657-36661679 CCTGGAGTCACACTCCTGCTTCA 0: 1
1: 0
2: 1
3: 21
4: 265
Right 988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 374
988990024_988990031 16 Left 988990024 5:36661639-36661661 CCCAGCCTCATGACTGGGCCTGG 0: 1
1: 0
2: 1
3: 34
4: 309
Right 988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 374
988990027_988990031 11 Left 988990027 5:36661644-36661666 CCTCATGACTGGGCCTGGAGTCA 0: 1
1: 0
2: 1
3: 18
4: 252
Right 988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG 0: 1
1: 0
2: 1
3: 33
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988990031 Original CRISPR CAGCTGTTCTTTGGCAAAGC AGG Intronic
900110426 1:1003169-1003191 GAGCTGTCCTGTGGCAAAGAAGG - Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900405183 1:2489904-2489926 CAGCTGTTCTTGGGAACTGCAGG - Intronic
900652674 1:3737979-3738001 CAGCTTTTCTGTGGCAAACAGGG - Intergenic
903418323 1:23200129-23200151 CAGCTGGTCAGTGGCAGAGCTGG - Intergenic
904266659 1:29322243-29322265 GAGCTGTTCATGGGCAAAGTTGG - Intronic
904338380 1:29812578-29812600 CAGCTGGACTCTGGCAGAGCTGG + Intergenic
904461438 1:30682857-30682879 CAGCTTGTCTCTGGCAGAGCTGG - Intergenic
906687697 1:47772946-47772968 CAGCTTTTCTTTGGCAAGAAGGG - Intronic
909116326 1:71541763-71541785 CAGCTGCTCTTTGGCAGGCCTGG - Intronic
909695220 1:78460768-78460790 CATCTGATCTTTGACAAAGCTGG - Intronic
909806642 1:79880998-79881020 CATCTGATCTTTGACAAAGCTGG + Intergenic
909807485 1:79889842-79889864 CATCTGATCTTTGACAAACCTGG - Intergenic
910070335 1:83206364-83206386 TAGCTGTGCATTGGCAAAGAAGG - Intergenic
911993276 1:104730275-104730297 CAACTGATCTTTGACAAAGCTGG - Intergenic
913044519 1:115062417-115062439 GAGCTGGTGTTTGGCAGAGCCGG + Intronic
913077671 1:115354639-115354661 CAGCTGTTCTTGGGAAATGCTGG - Intergenic
913092625 1:115489449-115489471 CAACTGATCTTTGACAAAGGAGG + Intergenic
913423206 1:118696434-118696456 CATCTGATCTTTGACAAACCTGG + Intergenic
913515525 1:119602478-119602500 GAGCTGATCCTTGGCAAAGTGGG + Intergenic
915633695 1:157171950-157171972 CAGCTAATATTTGGCAAGGCTGG + Intergenic
915637519 1:157196879-157196901 CAGCTAATATTAGGCAAAGCTGG + Intergenic
915657965 1:157377258-157377280 CAGCTAATATTTGGCAAGGCTGG + Intergenic
915671098 1:157489712-157489734 CAGCTAATATTTGGCAAGGCTGG - Intergenic
917025983 1:170642251-170642273 AAGCTAATCTTTAGCAAAGCAGG + Intergenic
917327033 1:173843738-173843760 GAGCTGTTCTTGGGAGAAGCTGG + Intronic
919414703 1:197293771-197293793 CATCTGATCTTTGACAAACCTGG + Intronic
920085913 1:203416825-203416847 CATCTGATCTTTGACAAACCTGG + Intergenic
921350046 1:214225594-214225616 CAGCTGCTCCTAGGCAAAGTTGG - Intergenic
922580333 1:226692553-226692575 CAGCTGTTCTGTGGCAGTGTAGG - Intronic
922843205 1:228661537-228661559 CATCTGATCTTTGACAAACCTGG + Intergenic
922901534 1:229140813-229140835 CAGCTGCTCAATGGCAGAGCTGG - Intergenic
923104989 1:230847539-230847561 CACCTGTTGTTTTGCAATGCAGG - Intronic
923155012 1:231270815-231270837 CACCTGGTCTTTGACAAGGCTGG - Exonic
924893985 1:248316452-248316474 CATCTGTCCCTTGGCAGAGCTGG + Intergenic
1062841707 10:678285-678307 CAGCTTTCCTCTGGAAAAGCAGG + Intronic
1063107760 10:3008407-3008429 CAGCTGGTCCTTGGGAAAGCTGG - Intergenic
1063246236 10:4221995-4222017 CAGCTTTTTTTTGTCAAAGCTGG + Intergenic
1063512203 10:6656373-6656395 CAGCTGTACTTTGGCACACATGG - Intergenic
1064348345 10:14553712-14553734 CAGCTGATATGTGGCAGAGCTGG - Intronic
1064865349 10:19872754-19872776 AGGCTGTTCTCTGGCAAAGAGGG + Intronic
1066156426 10:32683275-32683297 CATCTGATCTTCGACAAAGCTGG - Intronic
1066302333 10:34108127-34108149 CACCTGTCCTTTGGGAAAGATGG - Intergenic
1069298515 10:66877352-66877374 AAACTGTTCTTTTGCACAGCAGG + Intronic
1070229595 10:74550591-74550613 GATCTGTTCTTTGACACAGCTGG + Intronic
1070240520 10:74675632-74675654 CTGCTGTGCTTTGTCACAGCAGG + Intronic
1074713016 10:116193043-116193065 CAACTGTTCCTTGGTCAAGCTGG + Intronic
1074798043 10:116969227-116969249 AAGCTGGTCTCTGGCAAGGCTGG - Intronic
1076097930 10:127747932-127747954 CATCTGATCTTTGACAAACCTGG - Intergenic
1076455691 10:130592696-130592718 CATCTGATCTTTGACCAAGCTGG + Intergenic
1078336857 11:10471171-10471193 CATCTGATCTTTGACAAACCTGG + Intronic
1078806002 11:14704609-14704631 CAGTTGGTTTTTGGCAAAGGTGG + Intronic
1078808997 11:14738884-14738906 CATCTGGTCTTTGACAAACCTGG - Intronic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079676519 11:23233872-23233894 CAACTGTTTTTTGGCAAATATGG - Intergenic
1081655421 11:44853954-44853976 TACCTGTCCTTTGGCAAGGCCGG + Intronic
1082707283 11:56508063-56508085 CATCTGATCTTTGACAAACCTGG - Intergenic
1083509737 11:63197464-63197486 CATCTGATCTTTGACAAACCTGG + Intronic
1083528099 11:63390458-63390480 CATCTGATCTTTGACAAACCTGG - Intronic
1084361502 11:68670885-68670907 CATCTGATCTTTGACAAACCTGG - Intergenic
1085063167 11:73467385-73467407 CAGCTATTCTCTGACAGAGCTGG + Intronic
1085979221 11:81702226-81702248 CATCTGATCTTTGACAAACCTGG + Intergenic
1086073313 11:82822613-82822635 CAGCTCCTTTTTGGCAAAACTGG - Intergenic
1087311701 11:96551336-96551358 CAGCTGTGCTATGCCAGAGCTGG + Intergenic
1087473142 11:98602236-98602258 CAACTAATCTTTGGCAAAGGAGG - Intergenic
1087712665 11:101571728-101571750 CATCTGATCTTTGACAAACCTGG + Intronic
1087848707 11:103003531-103003553 CATCTGATCTTTGACAAAGCTGG + Intergenic
1088020825 11:105116606-105116628 CATCTGTTCTTTGACAAAGTGGG + Intergenic
1089166580 11:116482170-116482192 CAGCTGGTATGTGGCAGAGCAGG + Intergenic
1089233884 11:117006144-117006166 CCCCTGGTCTTTGGCACAGCAGG + Intronic
1089844036 11:121444463-121444485 CAGCGGGTCTCTGGCAGAGCCGG + Intergenic
1090499788 11:127250314-127250336 CAACTGTCCTTTGGGAAAGTGGG + Intergenic
1090841450 11:130491781-130491803 CACCTGATCTTTGACAAAGGAGG - Intergenic
1092731663 12:11540452-11540474 CAGCTGTTCTTTGTCTAGGCTGG + Intergenic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1093989797 12:25576974-25576996 CATCTGATCTTTGACAAACCTGG - Intronic
1095116051 12:38353468-38353490 CATCTGATCTTTGACAAATCTGG - Intergenic
1095141677 12:38671440-38671462 CAGCTGGTATTTGGAAATGCTGG + Intronic
1095564900 12:43611678-43611700 CATCTGATCTTTGACAAACCTGG + Intergenic
1095567480 12:43642404-43642426 CATCTGATCTTTGACAAACCTGG - Intergenic
1095736865 12:45567165-45567187 CAGCTGTTAGGTGGCAGAGCTGG - Intergenic
1095789620 12:46150525-46150547 CAGCTGTTCCTTGGGGAAGTGGG + Intergenic
1095855253 12:46853409-46853431 CATCTGATCTTTGACAAACCTGG + Intergenic
1095946233 12:47755188-47755210 CAGCTGCTAAGTGGCAAAGCTGG - Intronic
1096130697 12:49156558-49156580 CAACTGTTCGGTGGCAAACCTGG + Intergenic
1096608833 12:52787874-52787896 CAGCTGTGCTTTAGAAAAGCAGG - Intergenic
1097297194 12:57979434-57979456 CATCTGATCTTTGACAAACCTGG + Intergenic
1097622960 12:61963937-61963959 CATCTGATCTTTGACAAACCTGG + Intronic
1099699177 12:86062015-86062037 CATCTGTTCCTTAGCAGAGCTGG - Intronic
1106198491 13:27514886-27514908 CAGCAGCTCTGTGGCAGAGCTGG - Intergenic
1107094248 13:36517603-36517625 CAGCTGCTTTTTGGCATACCAGG - Intergenic
1107247856 13:38319318-38319340 CACCTGATCTTTGACAAACCTGG - Intergenic
1108343278 13:49518699-49518721 CAGCTGGTCAGTGGCAGAGCTGG + Intronic
1109194655 13:59365001-59365023 CAGCTGGCCACTGGCAAAGCTGG + Intergenic
1109394938 13:61744590-61744612 CATCTGATCTTTGACAAATCTGG + Intergenic
1109520251 13:63500834-63500856 CATCTGATCTTTGACAAACCTGG - Intergenic
1112646089 13:101333595-101333617 CAGCAGGGTTTTGGCAAAGCAGG + Intronic
1112676891 13:101711898-101711920 CAGCTGTTCTCTGGCTAGGCTGG + Exonic
1113309562 13:109117778-109117800 GAGCTGGTCATTGGCAAGGCAGG - Intronic
1114931728 14:27477687-27477709 CACCTGGTTTTTGGCAAACCGGG + Intergenic
1115018329 14:28643846-28643868 CATCTGATCTTTGACAAACCTGG + Intergenic
1116332672 14:43615271-43615293 AAACAGTTCTTTGCCAAAGCTGG - Intergenic
1117636073 14:57744950-57744972 CATCTGATCTTTGACAAACCTGG + Intronic
1118101932 14:62615703-62615725 AAGCTGTGATTTGGCAAAGCAGG + Intergenic
1118687400 14:68304671-68304693 CAGATGGTTTGTGGCAAAGCTGG - Intronic
1120044672 14:79792731-79792753 CAGCTGATCTTAGGAAAAGTGGG - Intronic
1120494117 14:85212722-85212744 CATCTGATCTTTGACAAACCTGG - Intergenic
1121470127 14:94146385-94146407 CAGCTAATAGTTGGCAAAGCTGG + Intronic
1122154135 14:99740250-99740272 CAGCTGGTCAATGGCAGAGCAGG + Intronic
1122588355 14:102826807-102826829 CAGCTGTCCTTTGGCAGCCCTGG - Intronic
1125354107 15:38798754-38798776 CATCTGATCTTTGACAAACCTGG - Intergenic
1126589566 15:50325352-50325374 CAGCTGATCTGTGGCAGAGGTGG - Intronic
1126956758 15:53941163-53941185 CATCTGATCTTTGACAAACCTGG + Intergenic
1127252233 15:57251593-57251615 CATCTGTTCTTTGGGACATCAGG + Intronic
1129013229 15:72441969-72441991 CATCTGATCTTTGACAAAGCTGG - Intergenic
1129228144 15:74181687-74181709 CAGCTATTCAGTGGCAGAGCTGG + Intronic
1129700046 15:77762632-77762654 CACCAGGTCTTTGGCCAAGCGGG + Intronic
1131821449 15:96278428-96278450 CAGCTTGTCTTTGTCCAAGCAGG + Intergenic
1132301062 15:100775820-100775842 CAGCTGCTCCGTGGCAGAGCGGG + Intergenic
1134032986 16:11007466-11007488 CAGCTGTTCAGGGGCAGAGCTGG - Intronic
1135782998 16:25322783-25322805 CAGCTGATGAATGGCAAAGCTGG + Intergenic
1136668434 16:31835857-31835879 CAACTGATCTTTGACAAAGTTGG + Intergenic
1138144436 16:54596046-54596068 CAGCCAGTCATTGGCAAAGCTGG - Intergenic
1138853152 16:60654887-60654909 CACCTGGCCTTTGACAAAGCTGG + Intergenic
1141369262 16:83472207-83472229 CAGCTGTTCAGTGGCAGAGCTGG + Intronic
1142240978 16:88944926-88944948 AGGCTGGTCTTTGGCAGAGCTGG + Intronic
1142905132 17:3036308-3036330 CAGCTGGCTGTTGGCAAAGCTGG + Exonic
1142995440 17:3757302-3757324 CAGGTGTACTTTGGTAAAACTGG - Intronic
1144129397 17:12231454-12231476 GAGTTATTGTTTGGCAAAGCTGG + Intergenic
1144703554 17:17353400-17353422 CAGGTGTTCCTGGGTAAAGCAGG + Intergenic
1146642094 17:34549260-34549282 CAGCTGTTCTATTTCCAAGCAGG - Intergenic
1146670306 17:34732981-34733003 CTGCTGTTCTTTCGCATTGCTGG - Intergenic
1147987220 17:44313547-44313569 CAGCTGTGTTTGGGCAATGCAGG - Intronic
1148572203 17:48678923-48678945 CAGCTGGTAATTGGCAGAGCAGG - Intergenic
1149191507 17:54068750-54068772 CATCTGATCTTTGACAAACCTGG - Intergenic
1150468742 17:65417675-65417697 CAGCTGGTCAGTGGCAGAGCTGG + Intergenic
1150888565 17:69116801-69116823 TAGCTGCTCTTTGGGAAATCAGG - Intronic
1153222261 18:2872033-2872055 TAACTGATCTTTGGCCAAGCTGG + Intronic
1153838914 18:8988979-8989001 GAGCTGGTCCATGGCAAAGCTGG + Intergenic
1154129679 18:11726038-11726060 CAACTGATCTTTGACAAAGGAGG - Intronic
1155536692 18:26825902-26825924 CAGCTGGTAAGTGGCAAAGCTGG + Intergenic
1156071645 18:33218734-33218756 CATCTGATCTTTGACAAACCTGG - Intronic
1156515741 18:37678641-37678663 CAGCTGATCTTTGGATAAACAGG + Intergenic
1157423223 18:47563310-47563332 CAGCTGGTAGGTGGCAAAGCAGG + Intergenic
1157525694 18:48379143-48379165 CAACTGATCTTTGACAAAGGAGG - Intronic
1158075416 18:53522627-53522649 CATCTGATCTTTGACAAACCTGG + Intronic
1159051641 18:63426024-63426046 CAGCTTTTATATGGCAGAGCTGG + Intergenic
1159475868 18:68920379-68920401 CATCTGATGTTTGGCAAACCTGG + Intronic
1159902781 18:74063641-74063663 CAGCTGTTTTATGGCAAAGGTGG - Intergenic
1164618114 19:29678610-29678632 CAGCGGTGCTGTGGCGAAGCAGG - Intergenic
1164665577 19:30032053-30032075 CAACTGATCTTTGGCAAAGGAGG - Intergenic
1165222725 19:34330321-34330343 CAGCTGCTGTTTGGCCAGGCTGG + Exonic
1165815017 19:38636674-38636696 CAGCTGTTAATTGGCAGAGCTGG + Intronic
1166534352 19:43562971-43562993 CAGCTGGTGGGTGGCAAAGCCGG + Intronic
926618609 2:15025247-15025269 CATCTGATCTTTGATAAAGCTGG - Intergenic
926735198 2:16068443-16068465 GAGCTGTCCTTTTGCAATGCTGG + Intergenic
927482172 2:23462702-23462724 AAGCTTTTCTTTGGGAAAGTGGG - Intronic
928466622 2:31528460-31528482 CAGATGTTCTGAGGCACAGCAGG - Intronic
928504980 2:31941708-31941730 CAGCTCCTCATTGGTAAAGCTGG - Intronic
929341558 2:40825067-40825089 TAGCTGGTCGTTGACAAAGCAGG - Intergenic
929494798 2:42431225-42431247 CAGCTATTCTTAGGAATAGCAGG - Intergenic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
933438390 2:82278013-82278035 CATCTGATCTTTGACAAAGCTGG + Intergenic
933589491 2:84216096-84216118 AATCAGTTTTTTGGCAAAGCAGG + Intergenic
933657311 2:84899622-84899644 CAGCTGGTCATTGGCATTGCTGG - Intronic
935186875 2:100742716-100742738 CAGCTGTTCTTGATCAAGGCTGG - Intergenic
935684294 2:105669933-105669955 CTGCTGCTCCTGGGCAAAGCTGG + Intergenic
936455670 2:112672043-112672065 CAACTATTATTTTGCAAAGCAGG - Intergenic
936457481 2:112686495-112686517 CAGGTGTTCCTTGGCTGAGCAGG + Intergenic
938445880 2:131378134-131378156 CATCTGATCTTTGACAAACCTGG + Intergenic
940196727 2:151103424-151103446 CAGATCTTCTTGGGCAAACCTGG - Intergenic
940906405 2:159173839-159173861 CAGCTTTTCTCTGGCCAACCTGG - Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
942162553 2:173207010-173207032 CTGCTGTTCTTTTGCAATGAGGG + Intronic
942984238 2:182120189-182120211 CATCTGATCTTTGACAAACCTGG - Intronic
943925151 2:193766852-193766874 CATCTGATCTTTGACAAACCTGG + Intergenic
944514052 2:200493484-200493506 CAGCTAATCAGTGGCAAAGCTGG - Intronic
946224045 2:218252942-218252964 CAGCTTCTCTTTGGCAGAGTTGG + Intronic
946567425 2:220982282-220982304 GAGCTGTTCTTTTTCAAAGACGG - Intergenic
946577262 2:221089127-221089149 CAGCTATGCATTGGCATAGCAGG + Intergenic
946746492 2:222851530-222851552 CATCTGATCTTTGACAAAGTTGG + Intergenic
947233842 2:227919822-227919844 AAGCTGATATTTTGCAAAGCAGG - Intronic
947370358 2:229439479-229439501 CAGCTGTTCGGAGGCAAAGCTGG + Intronic
948269009 2:236659446-236659468 CACATTTTCTTTGGCAATGCTGG + Intergenic
948288450 2:236806057-236806079 CAGCTATTCAATAGCAAAGCTGG + Intergenic
948535445 2:238643050-238643072 CAGCAGGGCTTTGGTAAAGCAGG - Intergenic
1169591852 20:7152068-7152090 TATCTGTTCTTTGCTAAAGCTGG - Intergenic
1170014379 20:11764665-11764687 CATCTGATCTTTGACAAACCTGG + Intergenic
1170330488 20:15205179-15205201 CAGATGGTATGTGGCAAAGCTGG + Intronic
1170510670 20:17073169-17073191 CATCTGATCTTTGACAAACCTGG - Intergenic
1172539645 20:35701027-35701049 CAGAAGATCCTTGGCAAAGCTGG - Intergenic
1172690857 20:36788703-36788725 CAGCTAGTAATTGGCAAAGCTGG - Intronic
1173476573 20:43364050-43364072 CAGCTGGTCAGTGGCAGAGCCGG + Intergenic
1173545323 20:43893451-43893473 CAGCTAGTCTTTGGCAGAGCTGG - Intergenic
1173867207 20:46319990-46320012 CAGGTGTTCTGGGGCAGAGCTGG + Intergenic
1174373144 20:50107468-50107490 CAGATTTTCTTTGACAAAGGGGG + Intronic
1174857639 20:54061870-54061892 CCGCTGTTCTTTGCCAACCCTGG - Intronic
1175796902 20:61776925-61776947 CAGCTGGTCTCTGTCGAAGCAGG + Intronic
1175906410 20:62381704-62381726 CAGCTGTTTCTGGGCCAAGCAGG - Intergenic
1180524623 22:16245118-16245140 GAGCTGTACTTTGGTAAATCAGG + Intergenic
1181969194 22:26677556-26677578 CAGCAGGTGTGTGGCAAAGCTGG - Intergenic
1182280953 22:29217414-29217436 CAGCTGGTGTGTGGCAGAGCTGG - Intronic
1182755130 22:32673174-32673196 AGGATGTTCTTTGGCAAAGGTGG + Intronic
1184815965 22:46870196-46870218 CAGATAGTCTTTGGCCAAGCTGG + Intronic
949455970 3:4239057-4239079 CATCTGATCTTTGACAAACCTGG - Intronic
950362991 3:12462932-12462954 CAGCTCTTACTTAGCAAAGCAGG + Intergenic
950796876 3:15517302-15517324 CAGCTGTTATGTGGGAGAGCTGG - Intronic
952358213 3:32604347-32604369 CAGCAGTTCAGGGGCAAAGCAGG + Intergenic
952535349 3:34303630-34303652 CAACTTTTCTTTGGCAAACATGG - Intergenic
952836018 3:37602868-37602890 CAGCCATTGTTTGGCAGAGCTGG + Intronic
953052983 3:39362483-39362505 CAGCTGCTTTTTGGTAGAGCAGG - Intergenic
953242284 3:41160323-41160345 CAGATGATCTTTGTCAGAGCAGG + Intergenic
954384637 3:50237660-50237682 CAGCTGGCCTTTTGCAAAGACGG + Intronic
958076751 3:88690589-88690611 TAGCTGCCCTTTGGCAGAGCAGG - Intergenic
958409819 3:93802672-93802694 CATCTGATCTTTGACAAACCTGG - Intergenic
958875444 3:99611079-99611101 CATCTGATCTTCGACAAAGCTGG - Intergenic
959314389 3:104784076-104784098 CAGCAGATCTTTGTAAAAGCAGG + Intergenic
959417937 3:106099813-106099835 CATCTGATCTTTGACAAACCTGG - Intergenic
959463344 3:106653503-106653525 CATCTGATCTTTGACAAAGCTGG + Intergenic
960224376 3:115152125-115152147 CAGCTGGTCTTAGGCACAGCTGG - Intergenic
960895000 3:122494414-122494436 CAACTGATCTTTGACAAAGTTGG - Intronic
961586606 3:127933321-127933343 CAGCTTTTTTTTGCCAAAGGGGG + Intronic
962287233 3:134097005-134097027 CATCTGATCTTTGACAAACCTGG - Intronic
964615815 3:158664007-158664029 CAGCTATTGCATGGCAAAGCTGG - Intronic
964759459 3:160120754-160120776 CATCTGATCTTTGACAAACCTGG + Intergenic
966680367 3:182635839-182635861 CAGCTGATCTTGGGGAAGGCTGG - Intergenic
966956138 3:184881435-184881457 CAGCTGATTTTTGACAAAGCTGG - Intronic
967139398 3:186541544-186541566 CAGCTCTTCATTGGCAAAACAGG + Intronic
967182380 3:186917638-186917660 CAGCTGTTCGTTGGGTGAGCTGG + Intergenic
967786082 3:193497989-193498011 CTGTTGTTCTTTTGCAGAGCAGG + Intronic
968040033 3:195581158-195581180 TAACTGTTCTTTGGAAAACCAGG - Intronic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
969606973 4:8206646-8206668 CAGCTTTCCCTTGGCCAAGCAGG - Intronic
969947292 4:10797497-10797519 CAACTGATCTTTGACAAAGCAGG + Intergenic
969970579 4:11043551-11043573 CATCTGATCTTTGACAAACCTGG - Intergenic
970014129 4:11493654-11493676 CAGCTGATCAGTGGCAAAGCTGG + Intergenic
970451603 4:16172298-16172320 CAATTATTATTTGGCAAAGCAGG + Intronic
972148441 4:36059421-36059443 CAGCTAATGATTGGCAAAGCTGG - Intronic
972453435 4:39228256-39228278 AAGGTGTTCTTTGGGAAAACTGG + Exonic
972472175 4:39416850-39416872 CAGCAGTCCGTTGGCAAAGAAGG - Intronic
973178847 4:47243168-47243190 CATCTGATCTTTGACAAACCTGG - Intronic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
974110460 4:57519769-57519791 CATCTGATCTTTGACAAACCTGG + Intergenic
974360786 4:60876379-60876401 CACCTGATCTTTGACAAACCTGG - Intergenic
975723811 4:77272844-77272866 CAGCAAGTCTTTGGAAAAGCTGG + Intronic
976363589 4:84208453-84208475 CATCTGATCTTTGACAAACCCGG + Intergenic
978305755 4:107326895-107326917 CAAGTGATCTTTGACAAAGCAGG - Intergenic
978650748 4:111001732-111001754 CAGCTATTGTTTTGCATAGCTGG - Intergenic
980136939 4:128867180-128867202 CAGCAAATCATTGGCAAAGCTGG + Intronic
981290266 4:143066909-143066931 CATCTGATCTTTGACAAACCTGG - Intergenic
981549566 4:145929948-145929970 CAGCTAGTCAGTGGCAAAGCTGG + Intronic
983727188 4:170942948-170942970 CATCTGATCTTTGCCAAACCTGG + Intergenic
983757247 4:171355198-171355220 CATCTGATCTTTGACAAATCTGG - Intergenic
984574800 4:181435640-181435662 CATCTGATCTTTGACAAACCTGG - Intergenic
988164823 5:27573641-27573663 CAACTGATCTTTGACAAAGTGGG + Intergenic
988269519 5:28995861-28995883 CATCTGATCTTTGACAAACCTGG + Intergenic
988990031 5:36661678-36661700 CAGCTGTTCTTTGGCAAAGCAGG + Intronic
990491920 5:56310978-56311000 CAGCTGTTTTTTGTCAAAATCGG - Intergenic
990519683 5:56566861-56566883 CAGGTGTTCTTGGGAAGAGCAGG - Intronic
990600053 5:57349149-57349171 CAGAGGTTCTTTGGCTAAACTGG + Intergenic
990923013 5:60988638-60988660 CATCTGATCTTTGACACAGCTGG + Intronic
991346901 5:65678704-65678726 CATCTGATCTTTGACAAACCTGG + Intronic
991596354 5:68310752-68310774 CAGCTGGTTTGTGGCAGAGCTGG + Intergenic
991598270 5:68326657-68326679 CAGGTGTTCCCTGGCAAAACAGG + Intergenic
992124802 5:73628776-73628798 CATCTCTACTTAGGCAAAGCTGG + Intronic
992608505 5:78486760-78486782 CACCTGCTCTTTGGCTAAGGTGG - Exonic
993531460 5:89029935-89029957 CAACTGTTTTCTGTCAAAGCAGG - Intergenic
993619527 5:90151581-90151603 CATCTGGTCTTTGACAAACCTGG + Intergenic
993627465 5:90243075-90243097 CATCTGATCTTTGACAAACCTGG + Intergenic
994517006 5:100784885-100784907 CATCTGATCTTTGACAAACCTGG + Intergenic
994526925 5:100917300-100917322 CATCTGATCTTTGACAAACCTGG - Intergenic
995628869 5:114111188-114111210 CATCTGATCTTTGACAAACCTGG + Intergenic
996012623 5:118498050-118498072 TATCTGATCTTTGACAAAGCTGG - Intergenic
997601631 5:135142623-135142645 CAGCTGTGCTTTGGGGAAGGGGG - Intronic
997665415 5:135626286-135626308 CAGCTGTTTTTCTGCAAAGTGGG + Intergenic
998202228 5:140134225-140134247 CAGATGGTCTCTGGCAAAGTGGG - Intergenic
998388186 5:141770400-141770422 CAGCTGGTAAGTGGCAAAGCCGG - Intergenic
998913597 5:146990431-146990453 CAACTGTTTTTTGCCAAAGGTGG + Intronic
999065940 5:148685580-148685602 CAGCTGGGCAGTGGCAAAGCTGG + Intergenic
999578721 5:153010327-153010349 CAGCTTATCTTTTGGAAAGCAGG + Intergenic
999649337 5:153750060-153750082 CAGCTCTTCCCTGGCAGAGCTGG - Intronic
1000245507 5:159445739-159445761 CAGCTATTAAGTGGCAAAGCTGG + Intergenic
1001581775 5:172803640-172803662 CTGATGTTCTATGGCACAGCAGG - Intergenic
1001792491 5:174470752-174470774 CATCTGATCTTTGACAAACCTGG + Intergenic
1001807533 5:174600526-174600548 CAGCTGTGATGTGGCAAAGCTGG - Intergenic
1001870645 5:175151338-175151360 CAGCTGGTCAATGGCAGAGCTGG + Intergenic
1002312634 5:178323920-178323942 CAGCTGGTATGTGGCAGAGCTGG + Intronic
1002385708 5:178865231-178865253 CAGCTGTTCAGTGGTAGAGCGGG - Intronic
1003119256 6:3306538-3306560 CAGCTATTCAATGGCAGAGCTGG + Intronic
1003407634 6:5836945-5836967 CTGCTGTTGTTTGACAAAGTTGG - Intergenic
1003624431 6:7728464-7728486 CAAATGTTCTGTGGCAAACCCGG + Intronic
1003710628 6:8585559-8585581 CATCTGATCTTTGACAAACCTGG - Intergenic
1003893864 6:10588473-10588495 TAGCTTTTCATAGGCAAAGCTGG + Intronic
1003896570 6:10613854-10613876 CAGCTGGTTAGTGGCAAAGCTGG + Intronic
1005677748 6:28173150-28173172 CAGCTCTTCCTTGGCTGAGCAGG + Intergenic
1006885960 6:37382545-37382567 CAGCTGATCTTGGCCAAATCTGG - Intronic
1006997927 6:38280035-38280057 CAGATGTTCTTTGGAAAAGCAGG - Intronic
1007174897 6:39888912-39888934 CAGCCTTTCTTGGGGAAAGCTGG + Intronic
1007864011 6:44948082-44948104 CATCTGATCTTTGACAAATCTGG - Intronic
1007963955 6:45986379-45986401 CAGCTAATCATTGGCCAAGCTGG - Intronic
1008167455 6:48156216-48156238 CACCTGTTCTTCAACAAAGCTGG + Intergenic
1008253127 6:49265055-49265077 CAGCCTTTCTTTGGCAAACAGGG + Intergenic
1008855988 6:56087996-56088018 CAGCTTTTGTTTGAAAAAGCTGG + Intronic
1009457508 6:63874277-63874299 CATCTGATCTTTGACAAATCTGG - Intronic
1009512742 6:64573132-64573154 CATCTGATCTTTGACAAACCTGG + Intronic
1011110181 6:83828917-83828939 CAGCTGGTCAATGGCAATGCTGG - Intergenic
1011465218 6:87648569-87648591 TAGCTGGTAATTGGCAAAGCTGG - Intronic
1011950295 6:92956712-92956734 CATCTGATCTTTGACAAACCTGG + Intergenic
1012063493 6:94516415-94516437 CATCTGATCTTTGACAAACCTGG + Intergenic
1012836519 6:104276362-104276384 CATCTGATCTTTGACAAACCTGG + Intergenic
1013625222 6:111930278-111930300 CATCTGATCTTTGACAAACCTGG - Intergenic
1013683073 6:112546537-112546559 CATCTGATCTTTGACAAACCTGG + Intergenic
1014179479 6:118369284-118369306 CATCTGATCTTTGACAAAGTTGG + Intergenic
1014701517 6:124694591-124694613 CAGCTGCTCTTGAACAAAGCAGG + Intronic
1014906103 6:127030201-127030223 CACATGTTCTATTGCAAAGCAGG - Intergenic
1015374347 6:132492643-132492665 CAACTGTTAAGTGGCAAAGCTGG - Intronic
1016847907 6:148587423-148587445 CAGCTGCTTTTTGGTAGAGCAGG + Intergenic
1017141697 6:151196750-151196772 CAGCTGTTCTGTGGGCCAGCTGG - Intergenic
1017783901 6:157738807-157738829 CATCTGATCTTTGACAAACCTGG + Intronic
1017968234 6:159285786-159285808 CATCTGATCTTTGACAAACCTGG - Intergenic
1019181012 6:170187325-170187347 CAGCTCCTCTTTGGCAAGGCTGG - Intergenic
1019608487 7:1922762-1922784 CAGATGCTCTTTGGCAAACTTGG + Intronic
1019959574 7:4447958-4447980 AAGCTTTTCTTTTGCAAGGCCGG + Intergenic
1020260518 7:6528412-6528434 CAGCTGGCCTGTGGCACAGCTGG + Intronic
1023286476 7:38626403-38626425 CATCTGATCTTTGACAAATCTGG + Intronic
1023298206 7:38739021-38739043 CAGTTGTTAATTGGAAAAGCGGG - Intronic
1023568725 7:41550864-41550886 CATCTGATCTTTGACAAACCTGG - Intergenic
1024331091 7:48156114-48156136 CAGCTGTTCTTTGACATCCCTGG - Intergenic
1024372483 7:48602506-48602528 CATCTGATCTTTGACAAAACTGG - Intronic
1027288051 7:76671224-76671246 CAGCTGTGCATTGGCAAAGAAGG - Intergenic
1028646094 7:93098239-93098261 CTGGTGTTCTTTGGAAAAGTGGG + Intergenic
1030055351 7:105579416-105579438 CAGCTGTACTGTGGCAAAAGAGG + Intronic
1030289234 7:107855801-107855823 CAGCTGTTTTTTGGTAGAGATGG - Intergenic
1030982378 7:116201350-116201372 CAGATGTATTTTGGCAAAGCTGG + Intergenic
1031312014 7:120210649-120210671 CATCTGATCTTTGACAAACCTGG + Intergenic
1032477821 7:132224361-132224383 CAGCTCTTCCTTGGTCAAGCAGG - Intronic
1032911316 7:136433744-136433766 CATCTGATCTTTGACAAACCTGG + Intergenic
1033532369 7:142277822-142277844 CATCTCATCTTTGACAAAGCTGG + Intergenic
1034201387 7:149285155-149285177 CAGCTTTTCATTGGCCAACCCGG - Intronic
1034360357 7:150491355-150491377 CATCTGATCTTTGACAAACCTGG + Intergenic
1036095300 8:5717612-5717634 CACTTCCTCTTTGGCAAAGCAGG + Intergenic
1037966595 8:23138943-23138965 CAGCTGTGCTTAGGGAAGGCAGG - Intronic
1038232384 8:25714530-25714552 CAGCTATTATGTGGCAGAGCTGG - Intergenic
1039011851 8:33102264-33102286 CAGCTGTTCAAAGGCAAAGGTGG + Intergenic
1039092140 8:33843667-33843689 CAGCTATACTTTGGCATGGCTGG + Intergenic
1039099457 8:33925163-33925185 CAACCCTTCTTTGGCAAAGAAGG - Intergenic
1039179730 8:34852688-34852710 CAGCTTTTCAGTGGCAAAACTGG + Intergenic
1039808063 8:41019579-41019601 CATCTGATCTTTGACAAACCTGG - Intergenic
1039809457 8:41033209-41033231 CATCTGATCTTTGACAAACCTGG + Intergenic
1040691701 8:49946609-49946631 TTTCTGTTCTTTGGAAAAGCAGG + Intronic
1041629509 8:60070087-60070109 AATCTGTTCTTTAGCAAAACAGG + Intergenic
1042774058 8:72410035-72410057 CACCTGATCTTTGACAAACCTGG + Intergenic
1043688267 8:83115986-83116008 CATCTGATCTTTGACAAATCTGG - Intergenic
1043866530 8:85381466-85381488 CATCTGATCTTTGACAAATCTGG - Intronic
1043913166 8:85888438-85888460 CACCTCTTCTTTGCCAAAACTGG - Intergenic
1045418675 8:101992547-101992569 CAGCTGGTAAGTGGCAAAGCTGG - Intronic
1045708850 8:104959970-104959992 CATCTGATCTTTGACAAACCTGG - Intronic
1045794622 8:106028153-106028175 CAACTGATCTTTGACAAACCTGG + Intergenic
1045831844 8:106471052-106471074 GAGGTGTTTTTTGGCAAAGGAGG + Intronic
1046793677 8:118347950-118347972 CAGCTGATCACTGGCACAGCTGG - Intronic
1047585521 8:126268293-126268315 CAGCTTTACTATCGCAAAGCAGG - Intergenic
1047890063 8:129298500-129298522 CAACTGGTCTTTGACAAAGTTGG + Intergenic
1048320542 8:133396261-133396283 GATCTCTGCTTTGGCAAAGCAGG + Intergenic
1049013215 8:139901793-139901815 CAGCTGGTCCGTGGCAGAGCCGG - Intronic
1049919663 9:351478-351500 CAGCTGCCCATTGGCAAATCAGG + Intronic
1050217200 9:3340111-3340133 CATCTGATCTTTGACAAACCTGG + Intronic
1050570432 9:6932581-6932603 CAGCTGTTATTTGGGGAAGGAGG + Intronic
1050932650 9:11349456-11349478 CATCTGTTCTTTGCCAGAGGAGG - Intergenic
1051529585 9:18085264-18085286 CAGCTGGTAAGTGGCAAAGCTGG - Intergenic
1052067337 9:24038298-24038320 CAGCTGCTCCTTGGCAGTGCGGG + Intergenic
1053474841 9:38375363-38375385 CAGCTGTTTATTTGCAAAGCCGG - Intergenic
1054745638 9:68851820-68851842 CAGCTGTGCTTTGGAAGAGGGGG - Intronic
1054783499 9:69188216-69188238 TAGCTTTTCTCTAGCAAAGCTGG + Intronic
1055192353 9:73540839-73540861 CACCAGTTTTTTGACAAAGCAGG - Intergenic
1055744032 9:79423059-79423081 CATCTGATCGTTGGCAAACCTGG - Intergenic
1059036461 9:110759190-110759212 CATCTAGTCTTAGGCAAAGCTGG + Intronic
1059055948 9:110979743-110979765 CAGATGTTCTTCTGCAAAACAGG + Intronic
1061187559 9:129063569-129063591 CAGCTTTTCTTCGGGAAAGTGGG + Exonic
1186956128 X:14684098-14684120 CATCTGATCTTTGACAAACCTGG - Intronic
1187519780 X:20003274-20003296 CAGCTGGAACTTGGCAAAGCTGG - Intergenic
1187620699 X:21050407-21050429 CATCTGATCTGTGACAAAGCTGG + Intergenic
1189260161 X:39672848-39672870 CTGCTGTTCAATGCCAAAGCTGG + Intergenic
1189268166 X:39731926-39731948 CAGCTGTTTCTTGGCAGAACTGG - Intergenic
1190126942 X:47714306-47714328 CATCTGATCTTTGACAAACCTGG + Intergenic
1190159331 X:48019105-48019127 CAGCTGCTCACTGGCATAGCTGG - Intronic
1190175044 X:48141333-48141355 CAGCTGCTCACTGGCATAGCTGG - Intergenic
1191027459 X:55929650-55929672 CATCTGATCTTTGACAAACCTGG - Intergenic
1191079187 X:56490755-56490777 CATCTGATCTTTGACAAACCTGG - Intergenic
1191625703 X:63268810-63268832 CATCTGATCTTTGACAAACCTGG + Intergenic
1191947293 X:66549191-66549213 CAACTGATCTTTGACAAAGTTGG + Intergenic
1191987042 X:66993222-66993244 CATCTGATCTTTGACAAACCTGG - Intergenic
1193063301 X:77230005-77230027 CATCTGATCTTTGACAAACCTGG + Intergenic
1193171802 X:78345990-78346012 CATCTGATCTTTGACAAATCTGG + Intergenic
1193176522 X:78400926-78400948 TGGCTGTTCTTTGGTAGAGCAGG - Intergenic
1193228012 X:79008707-79008729 CATCTGATCTTTGACAAATCTGG - Intergenic
1193674418 X:84432117-84432139 CATCTGATCTTTGACAAAGTTGG - Intronic
1193942221 X:87689948-87689970 CATCTGATCTTTGACAAGGCTGG - Intergenic
1194805403 X:98320816-98320838 CATCTGATCTTTGACAAACCTGG - Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195833329 X:109084618-109084640 CATCTGATCTTTGACAAACCTGG - Intergenic
1196510906 X:116510969-116510991 CACCTGATCTTTGACAAAGTTGG - Intergenic
1196553787 X:117062528-117062550 CATCTGATCTTTGACAAACCTGG - Intergenic
1196587656 X:117448279-117448301 CATCTGATCTTTGACAAACCTGG + Intergenic
1197744664 X:129923905-129923927 CAGTGGATCATTGGCAAAGCTGG + Intronic
1198102780 X:133436476-133436498 CAGTTGTGCTTTGGCTAACCTGG - Intergenic
1198376506 X:136045435-136045457 CACCTGTACTTTGGCTAAGCCGG - Exonic
1199466167 X:148139960-148139982 CATCTGATCTTTGACAAACCTGG - Intergenic
1199975162 X:152890624-152890646 CAGCTATTAATTGGCACAGCTGG + Intergenic
1201916417 Y:19186406-19186428 CATCTGATCTTTGACAAATCTGG - Intergenic