ID: 988992279

View in Genome Browser
Species Human (GRCh38)
Location 5:36683287-36683309
Sequence TACAATGACCCTTGTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988992279 Original CRISPR TACAATGACCCTTGTGAAGT TGG (reversed) Intronic
904708038 1:32406604-32406626 GACCATGTCCCTTGTGAAGAAGG - Intergenic
910475968 1:87607601-87607623 TCCAATGACACCTGTGAAGTGGG + Intergenic
911090985 1:94016646-94016668 TAGAATGAGCCCTGTGGAGTTGG + Intronic
911742360 1:101400890-101400912 TACAAAGACCATTGTGAGGAAGG - Intergenic
915801266 1:158795535-158795557 TGCAAGGTCCCTTGTGAGGTAGG + Intergenic
917767192 1:178233748-178233770 TCCACTGACCCAAGTGAAGTTGG - Intronic
918733252 1:188024901-188024923 GACAGTGACACATGTGAAGTGGG - Intergenic
920558092 1:206919092-206919114 TACCAGGACCCTTGTGCTGTGGG - Intronic
921182065 1:212639053-212639075 TACACTGACCCTCTTGAACTTGG + Intergenic
921341531 1:214138991-214139013 TAGAAAGAACCTTGTGAAGGAGG + Intergenic
921825530 1:219667898-219667920 TATAGTGACCCTTTGGAAGTAGG - Intergenic
923406479 1:233666219-233666241 TAGACTGGCCCTGGTGAAGTGGG + Intronic
924220618 1:241871311-241871333 TACTATAATCTTTGTGAAGTTGG - Intronic
1063478170 10:6346855-6346877 TGCAATGGCCCTTGGGAACTGGG - Intergenic
1068159025 10:53239751-53239773 TGCACTGAACCTTGTGTAGTTGG - Intergenic
1068853497 10:61772022-61772044 TACAATTACCCTTTTAAAATGGG - Intergenic
1071383855 10:85100143-85100165 TCCACTGACCCTTTTGGAGTAGG - Intergenic
1071906363 10:90178453-90178475 TACAATGAACTTTGAGAACTCGG - Intergenic
1080230468 11:30014262-30014284 ACCAATGGCCCTTGTTAAGTTGG + Intronic
1080276203 11:30505937-30505959 TACAATCTACCTTATGAAGTGGG + Intronic
1083903934 11:65658031-65658053 TCTCATGACCCTTTTGAAGTAGG - Intronic
1084994930 11:72967278-72967300 TAAAAAGACCCTTGTGTAGTGGG + Intronic
1085992313 11:81864052-81864074 TAAAAAGACCTTTGTAAAGTTGG - Intergenic
1086419300 11:86622620-86622642 TACAAAGAACAGTGTGAAGTGGG - Intronic
1088188124 11:107196443-107196465 GTCAATGCCCCTTTTGAAGTAGG + Intergenic
1088200110 11:107322940-107322962 TACAATGATCCCTGTGAGATGGG - Intergenic
1090453093 11:126823806-126823828 TACAGTGCCCCAGGTGAAGTAGG + Intronic
1091261024 11:134234306-134234328 CACACAGAGCCTTGTGAAGTAGG + Intronic
1091294395 11:134463229-134463251 TACAATGCCCATTGTATAGTAGG + Intergenic
1095856863 12:46869855-46869877 TACAAAGACCCTTGCAAAGGTGG - Intergenic
1098356835 12:69620018-69620040 TACCTTTACCTTTGTGAAGTAGG - Intergenic
1100353375 12:93806125-93806147 TACCATGAGCCTGGTGTAGTTGG + Intronic
1101282325 12:103271130-103271152 CACAGTGACCCCTGTAAAGTGGG + Intronic
1103291641 12:119851026-119851048 TAAAATGAACCCTGTGAAGTTGG + Intronic
1106231279 13:27823145-27823167 GACAATGACGCTGGTTAAGTTGG + Intergenic
1106374313 13:29170113-29170135 GACAAAGACCCTTGGGAAGGAGG + Intronic
1106615359 13:31322001-31322023 TACAATGAACTTTGGGAACTCGG - Intronic
1107649521 13:42530184-42530206 TAAAATGAACCTTGTGGTGTGGG - Intergenic
1113152900 13:107284227-107284249 TACAAAGACCCTGGAGAAGGGGG + Intronic
1116085385 14:40230854-40230876 TAACATGAACATTGTGAAGTTGG - Intergenic
1116241256 14:42346128-42346150 TAAAATGCCCGTTGTGAATTGGG + Intergenic
1120133547 14:80836387-80836409 TACAATAGCCCATTTGAAGTAGG - Intronic
1121695163 14:95906377-95906399 TAAAATGAGCCTTGTGATGTTGG - Intergenic
1126151996 15:45531666-45531688 TAGTACAACCCTTGTGAAGTGGG - Intergenic
1126836885 15:52677251-52677273 TCCAAGGAACATTGTGAAGTGGG - Intronic
1127093631 15:55491359-55491381 TTCCATGTTCCTTGTGAAGTTGG - Intronic
1127265504 15:57357777-57357799 TACAATGAACCCTGTCATGTTGG + Intergenic
1131859072 15:96632828-96632850 TACAACCACCCTTGTGAGGAAGG + Intergenic
1132324648 15:100958737-100958759 CACAATAACCCCTCTGAAGTAGG + Intronic
1133539129 16:6731695-6731717 TACAATGAGCCTAGTCATGTGGG - Intronic
1140411555 16:74744019-74744041 GACAAAGACCCTTCTGAAGAAGG + Intronic
1140810941 16:78577202-78577224 TACAATTTCCCTTCTGAAGCTGG - Intronic
1143032397 17:3975016-3975038 TACAATGACCTTCGTGCAGTGGG - Intergenic
1143736989 17:8917994-8918016 TGGAATGAACCTTGTGGAGTTGG + Intronic
1146979724 17:37149149-37149171 TGGAAAAACCCTTGTGAAGTTGG + Intronic
1149777240 17:59367596-59367618 TAGAATGACTGTTGTGAAATGGG + Intronic
1152552497 17:81036567-81036589 TTCAATAAAGCTTGTGAAGTTGG + Intronic
1152771097 17:82169793-82169815 TAGAATGAACCTTTTGATGTTGG + Intronic
1154050543 18:10952351-10952373 TACAATGACCATGGAGAATTTGG - Intronic
1157265229 18:46213641-46213663 TACAAATATGCTTGTGAAGTAGG + Intronic
1158282724 18:55845075-55845097 TGCAATGACCCATGTAATGTGGG + Intergenic
1158444999 18:57511861-57511883 TCCAAGGACTCTTGAGAAGTGGG + Intergenic
1163988142 19:20971836-20971858 CACAATGCCCCTTGTGACTTTGG - Intergenic
1166045419 19:40226969-40226991 TAGAATGACCCTTGTGGTGTCGG + Intergenic
927181475 2:20449470-20449492 TAAAAATACCCTTGTGAATTTGG + Intergenic
928865841 2:35916722-35916744 CACAATGCCCCTTGTGAAGCAGG - Intergenic
929123069 2:38499267-38499289 TACATTGTCCCTTGTGTGGTAGG - Intergenic
932166313 2:69510895-69510917 TACAAGGACTCTTGTGATGTGGG + Intronic
932450441 2:71807080-71807102 TATAATGATGCTTGTGAAGGTGG + Intergenic
933431349 2:82183745-82183767 GACAATGACTCTAGTGAGGTTGG - Intergenic
939401138 2:141695372-141695394 TGCAATGACCCTTTTAAAGTAGG - Intronic
939670689 2:145007912-145007934 TACAATGAACCTTCTGATGATGG - Intergenic
942515958 2:176753442-176753464 TCAAAAGAACCTTGTGAAGTAGG + Intergenic
944438119 2:199713351-199713373 GACAATGATCCTTGAGAAATTGG + Intergenic
947293433 2:228603276-228603298 TACAGTGAGCATTGGGAAGTTGG + Intergenic
947708127 2:232292883-232292905 TACCAGGACCGTTGTGCAGTTGG + Intronic
948623523 2:239251706-239251728 AATAATGAGCCTTGTGCAGTGGG - Intronic
1169916441 20:10688333-10688355 CACACTGACGCTTGTCAAGTAGG + Intergenic
1171280850 20:23896521-23896543 TACAATGAACTTTGGGAACTTGG + Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175996374 20:62813903-62813925 TAAATTGACCCTTCTGGAGTGGG + Exonic
1176950581 21:15041360-15041382 TACAATAAGCCTTCTGGAGTAGG + Intronic
1177289048 21:19086431-19086453 TACAAGGACACTTGTGATTTAGG - Intergenic
1179583234 21:42358318-42358340 TACTATGACCCTGGTGGAGAAGG - Intergenic
949520274 3:4845671-4845693 TTCAATGACTCTTGAGTAGTTGG - Intronic
950101202 3:10358039-10358061 TCCCTTGATCCTTGTGAAGTGGG + Intronic
951995214 3:28719965-28719987 TAGAATGATGCTTGTGAAGGTGG - Intergenic
952839075 3:37629057-37629079 CACAATCACCCTCGTGAGGTAGG - Intronic
955054619 3:55444598-55444620 TACAGTTACCCTAGTGAGGTGGG - Intergenic
957365964 3:79224554-79224576 TACTATGAGCATTGTAAAGTGGG - Intronic
957850568 3:85801299-85801321 TTAAATGACCCTTGTTAATTTGG - Intronic
958823956 3:99007678-99007700 TACAAAGACTGTTGTGAAGTGGG - Intergenic
959894406 3:111590245-111590267 TAACATCACCCTTGTGAAGTTGG - Intronic
960148523 3:114228715-114228737 TACAATTACCCTTGGGATGGTGG + Intergenic
960307442 3:116079068-116079090 TAAAATGAACCTTGTGATGTTGG - Intronic
963750879 3:149178650-149178672 TTCAGTAACCCTTGTGAATTAGG + Intronic
965456063 3:168902402-168902424 TGCAGAGACCCTTGTGAAGAAGG - Intergenic
966172190 3:177094795-177094817 TACAATGGACCTTGTGGACTAGG + Intronic
969311676 4:6356579-6356601 TGCAATTGCCCTTCTGAAGTTGG - Intronic
975294806 4:72721605-72721627 TACAACAACCCTTATGAAGTAGG - Intergenic
976883096 4:89954273-89954295 CACAATAACCCTTGTAAAGTGGG + Exonic
979640476 4:123007896-123007918 GACAATGACCCTTGAGAAAAGGG - Intronic
979940061 4:126751224-126751246 TAAAATGAGCCTAGTGATGTTGG - Intergenic
981419440 4:144532558-144532580 TACAATGACCCCCATGAAGTAGG - Intergenic
983296464 4:165874052-165874074 TACAAGGACCCGTGTAAAGCCGG + Exonic
983789576 4:171779748-171779770 TACAATGACCCCTGAGAAAAAGG - Intergenic
984871854 4:184332577-184332599 TTCCATCAACCTTGTGAAGTAGG + Intergenic
988465631 5:31488865-31488887 TACAGTGACCATTCTGATGTGGG + Intronic
988992279 5:36683287-36683309 TACAATGACCCTTGTGAAGTTGG - Intronic
990250878 5:53913633-53913655 CACAATGAACCTTGTGATATAGG - Intronic
992852217 5:80822568-80822590 TCAAATCAACCTTGTGAAGTCGG - Intronic
994371229 5:98969928-98969950 TACACTGAGCCTTGTCTAGTAGG + Intergenic
994513785 5:100743615-100743637 TAAAATGGTCATTGTGAAGTCGG - Intergenic
994824820 5:104699230-104699252 TACAGAGACCATGGTGAAGTGGG + Intergenic
999168034 5:149568009-149568031 TAGAATGCACCTTGTGAAGTTGG - Intronic
1001397415 5:171427230-171427252 CACAATAACCCTTAAGAAGTAGG - Intronic
1003177037 6:3759383-3759405 TACTATGACCCATTTGAAGATGG - Intergenic
1004862767 6:19822424-19822446 TACAAAGAGCCTTGTGAAGTGGG + Intergenic
1009355563 6:62740204-62740226 TACAGTGAGCCTTGGGGAGTAGG - Intergenic
1009785178 6:68327754-68327776 TACAATAATCCTTGTGTAGGTGG - Intergenic
1010609721 6:77939534-77939556 TACAGTGAATCGTGTGAAGTAGG - Intergenic
1010767465 6:79792716-79792738 TAGAATGAACCTCGTGATGTTGG - Intergenic
1011697732 6:89928003-89928025 TACAATGCCCTGTGTGGAGTTGG - Exonic
1015467547 6:133563661-133563683 TGGATTGACCCTTGTGAAATTGG - Intergenic
1017682236 6:156876049-156876071 TACACTGTCCTTTTTGAAGTTGG + Intronic
1020672027 7:11128065-11128087 TACAGTGAATCTTGAGAAGTTGG - Intronic
1024358235 7:48440281-48440303 TTCAATTACCCTTGTGAGGAGGG - Intronic
1025780958 7:64601389-64601411 CACAATGTCCCTTGTGGACTAGG - Intergenic
1026530587 7:71193998-71194020 TAAAAGTAACCTTGTGAAGTAGG + Intronic
1029053644 7:97717021-97717043 TACAATGAACTTTGAGAACTGGG + Intergenic
1031736508 7:125369118-125369140 TAAAATGACCCTTGGTAAGTAGG + Intergenic
1031819394 7:126480636-126480658 TAGAATGACCCTTGTAATGTTGG + Intronic
1032109769 7:129066027-129066049 TACAGGGACCCTTCTGAAATGGG - Intergenic
1037651073 8:20839134-20839156 TAAAATAAACCTTGTGAGGTTGG + Intergenic
1040570972 8:48609589-48609611 GACAATGACATTTGTGATGTTGG - Intergenic
1042886834 8:73561838-73561860 CACAATGACCCTCAAGAAGTAGG + Intronic
1044758336 8:95490355-95490377 CACAATGAACCTTGTGACATAGG + Intergenic
1044763158 8:95543840-95543862 TACATTGACACTTGTGCAGGAGG + Intergenic
1045401292 8:101821371-101821393 TACAATGACCTTTGATAGGTAGG + Intronic
1045557648 8:103230415-103230437 TCCAAAAAGCCTTGTGAAGTAGG + Intergenic
1046659886 8:116938126-116938148 TTCAAGGACCCTTGCCAAGTGGG - Intergenic
1047342431 8:123994813-123994835 TACAAGGTCCCCTGTGAGGTAGG + Intronic
1048715814 8:137268020-137268042 TAGAATGAGCCTTGTGGTGTTGG + Intergenic
1050000621 9:1073599-1073621 TACAATTTAACTTGTGAAGTAGG + Intergenic
1050623589 9:7480031-7480053 TTCCATGACCCTTGTGAATCTGG - Intergenic
1052376863 9:27727497-27727519 TACAATTATCCCTGTGTAGTAGG + Intergenic
1053314531 9:37040584-37040606 TACAATGACTATTGTCAAGGAGG - Intergenic
1053419662 9:37969488-37969510 CACCAAGACCCTTCTGAAGTGGG + Intronic
1055413724 9:76059908-76059930 TGGAATGACACTTTTGAAGTGGG + Intronic
1056052713 9:82786440-82786462 TACATTTACCCTTGTGGAATAGG + Intergenic
1058362152 9:104161048-104161070 TACAATAAATCTTGTGAACTTGG - Intergenic
1058536391 9:105964579-105964601 TACTATGACCTTTGGGAAGCAGG + Intergenic
1185580844 X:1210658-1210680 TACAGTGAACCTTGTCATGTTGG + Intronic
1189948001 X:46199858-46199880 TAGAATGAACCTTGTGGTGTTGG + Intergenic
1192208789 X:69113670-69113692 CACCATGCCCCCTGTGAAGTAGG - Intergenic
1192619156 X:72659579-72659601 TAGAATGAACCTTGTGATGTTGG - Intronic
1194188846 X:90809108-90809130 TACAACAAACCTAGTGAAGTAGG + Intergenic
1197834646 X:130681674-130681696 TACAATAACCCTTGTAAGGTGGG - Intronic
1200535428 Y:4391005-4391027 TACAACAAACCTAGTGAAGTAGG + Intergenic