ID: 988995060

View in Genome Browser
Species Human (GRCh38)
Location 5:36706807-36706829
Sequence TTGGAGAACCACTGCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988995060_988995067 5 Left 988995060 5:36706807-36706829 CCCAGATGGCAGTGGTTCTCCAA No data
Right 988995067 5:36706835-36706857 GCTGCACATTGGAATTCCTTGGG No data
988995060_988995066 4 Left 988995060 5:36706807-36706829 CCCAGATGGCAGTGGTTCTCCAA No data
Right 988995066 5:36706834-36706856 GGCTGCACATTGGAATTCCTTGG No data
988995060_988995063 -6 Left 988995060 5:36706807-36706829 CCCAGATGGCAGTGGTTCTCCAA No data
Right 988995063 5:36706824-36706846 CTCCAACCTTGGCTGCACATTGG No data
988995060_988995069 30 Left 988995060 5:36706807-36706829 CCCAGATGGCAGTGGTTCTCCAA No data
Right 988995069 5:36706860-36706882 TCTTTCAAAACACTGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988995060 Original CRISPR TTGGAGAACCACTGCCATCT GGG (reversed) Intergenic
No off target data available for this crispr